Incidental Mutation 'R0426:Fam160a2'
ID38649
Institutional Source Beutler Lab
Gene Symbol Fam160a2
Ensembl Gene ENSMUSG00000044465
Gene Namefamily with sequence similarity 160, member A2
Synonyms4632419K20Rik, 6530415H11Rik
MMRRC Submission 038628-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0426 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location105371211-105400054 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 105389473 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tryptophan at position 186 (C186W)
Ref Sequence ENSEMBL: ENSMUSP00000074252 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048079] [ENSMUST00000074686] [ENSMUST00000118726] [ENSMUST00000122327] [ENSMUST00000137158] [ENSMUST00000179474]
Predicted Effect probably benign
Transcript: ENSMUST00000048079
AA Change: C186W

PolyPhen 2 Score 0.104 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000045084
Gene: ENSMUSG00000044465
AA Change: C186W

DomainStartEndE-ValueType
Pfam:RAI16-like 96 426 2.8e-99 PFAM
low complexity region 482 501 N/A INTRINSIC
low complexity region 527 544 N/A INTRINSIC
low complexity region 697 710 N/A INTRINSIC
low complexity region 718 730 N/A INTRINSIC
low complexity region 891 906 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000074686
AA Change: C186W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000074252
Gene: ENSMUSG00000044465
AA Change: C186W

DomainStartEndE-ValueType
Pfam:RAI16-like 96 426 4.4e-100 PFAM
low complexity region 482 501 N/A INTRINSIC
low complexity region 527 544 N/A INTRINSIC
low complexity region 697 710 N/A INTRINSIC
low complexity region 718 730 N/A INTRINSIC
low complexity region 825 840 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000118726
AA Change: C186W

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000112605
Gene: ENSMUSG00000044465
AA Change: C186W

DomainStartEndE-ValueType
Pfam:RAI16-like 96 426 1.8e-99 PFAM
low complexity region 496 515 N/A INTRINSIC
low complexity region 541 558 N/A INTRINSIC
low complexity region 707 722 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000122327
AA Change: C186W

PolyPhen 2 Score 0.481 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000112711
Gene: ENSMUSG00000044465
AA Change: C186W

DomainStartEndE-ValueType
Pfam:RAI16-like 96 426 5.6e-98 PFAM
low complexity region 482 501 N/A INTRINSIC
low complexity region 527 544 N/A INTRINSIC
low complexity region 697 710 N/A INTRINSIC
low complexity region 718 730 N/A INTRINSIC
low complexity region 891 906 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136298
Predicted Effect probably damaging
Transcript: ENSMUST00000137158
AA Change: C186W

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000119184
Gene: ENSMUSG00000044465
AA Change: C186W

DomainStartEndE-ValueType
Pfam:RAI16-like 96 259 7.2e-42 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000179474
AA Change: C186W

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000137163
Gene: ENSMUSG00000044465
AA Change: C186W

DomainStartEndE-ValueType
Pfam:RAI16-like 96 426 4.2e-98 PFAM
low complexity region 496 515 N/A INTRINSIC
low complexity region 541 558 N/A INTRINSIC
low complexity region 711 724 N/A INTRINSIC
low complexity region 732 744 N/A INTRINSIC
low complexity region 905 920 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210341
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211013
Meta Mutation Damage Score 0.1216 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.9%
Validation Efficiency 96% (86/90)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is part of the FTS/Hook/FHIP (FHF) complex, which can interact with members of the homotypic vesicular protein sorting (HOPS) complex. This interaction suggests that the encoded protein is involved in vesicle trafficking. [provided by RefSeq, Dec 2016]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830010M20Rik C T 5: 107,510,373 T1603I probably damaging Het
Abca8b G T 11: 109,955,027 probably benign Het
Acadl A T 1: 66,841,646 F320L probably damaging Het
Acsbg1 T C 9: 54,622,746 D222G probably benign Het
Anapc15 A G 7: 101,898,033 T39A probably benign Het
Ano3 A T 2: 110,661,174 V919E probably damaging Het
Arhgef12 T C 9: 42,970,990 probably null Het
Atad5 T A 11: 80,112,832 I1091N probably benign Het
Atf1 A T 15: 100,232,827 H26L possibly damaging Het
Atp10a T C 7: 58,784,734 M252T probably benign Het
Cd55 C T 1: 130,448,372 R347H probably benign Het
Cdc27 A C 11: 104,513,027 probably null Het
Cdh9 G A 15: 16,823,454 probably null Het
Cdk11b T C 4: 155,642,512 probably benign Het
Cep70 A G 9: 99,297,684 D567G probably benign Het
Cep78 A T 19: 15,970,970 Y382* probably null Het
Col9a2 T C 4: 121,044,660 probably benign Het
Cyp2d12 G A 15: 82,558,963 D409N probably benign Het
Ddx39 A G 8: 83,721,769 T217A probably benign Het
Dennd1b T A 1: 139,170,196 D733E probably benign Het
Dicer1 A G 12: 104,702,542 S1294P probably damaging Het
Dnah3 T C 7: 119,943,572 E3539G probably benign Het
Dnmbp A G 19: 43,852,436 probably benign Het
Dysf T C 6: 84,149,757 L1332P probably damaging Het
F5 A G 1: 164,182,840 D380G probably damaging Het
Fam171a1 T C 2: 3,225,396 V522A probably benign Het
Galr2 C A 11: 116,281,691 A69D probably damaging Het
Grk2 T C 19: 4,290,600 probably null Het
Gtf3c1 A T 7: 125,663,016 Y1119* probably null Het
Hgd A T 16: 37,588,685 probably benign Het
Ildr2 G T 1: 166,308,899 V436L probably benign Het
Intu G A 3: 40,675,305 C355Y probably damaging Het
Irf2bpl G T 12: 86,883,096 P268T probably benign Het
Jarid2 T C 13: 44,840,882 probably null Het
Jup A T 11: 100,372,401 M716K probably benign Het
Kank1 G A 19: 25,411,473 V809I probably damaging Het
Kdm1b T A 13: 47,064,244 probably benign Het
Kdm3a C T 6: 71,600,755 C687Y probably damaging Het
Kdm5d T A Y: 942,437 probably benign Het
Kifap3 T A 1: 163,865,552 probably benign Het
Macf1 T A 4: 123,483,660 K1400* probably null Het
Majin A G 19: 6,212,117 probably benign Het
Mb21d1 G A 9: 78,435,738 probably benign Het
Mctp1 A G 13: 77,020,821 I846V probably benign Het
Mrgpra2b T A 7: 47,464,127 I286F possibly damaging Het
Neil3 T G 8: 53,609,396 probably benign Het
Nox3 G T 17: 3,695,563 N23K probably damaging Het
Nt5c3 T C 6: 56,883,812 K219E probably benign Het
Olfr1458 G A 19: 13,103,278 R3C possibly damaging Het
Olfr213 A T 6: 116,540,485 N11Y probably damaging Het
Olfr389 T A 11: 73,776,437 M297L probably benign Het
Olfr524 A C 7: 140,202,116 F218C possibly damaging Het
Olfr548-ps1 T A 7: 102,542,686 I250N probably damaging Het
Olfr954 T C 9: 39,461,593 L54P probably damaging Het
Pacsin2 A G 15: 83,379,795 V347A possibly damaging Het
Pcdhb7 A T 18: 37,342,804 E331V probably damaging Het
Pcid2 A C 8: 13,081,262 probably null Het
Pcsk9 T C 4: 106,450,077 D323G possibly damaging Het
Pdhb T C 14: 8,169,801 E203G probably damaging Het
Phlpp2 A G 8: 109,928,463 Y630C probably benign Het
Pidd1 C T 7: 141,439,133 A812T probably damaging Het
Plau G A 14: 20,842,314 R389H probably benign Het
Plekhg6 G A 6: 125,364,629 probably null Het
Ppox T C 1: 171,277,749 Y321C probably damaging Het
Pxdn A G 12: 29,987,066 N281S possibly damaging Het
Pycrl A T 15: 75,918,388 M138K probably benign Het
Radil T C 5: 142,497,873 Y526C probably damaging Het
Ranbp3 C A 17: 56,707,169 D233E probably benign Het
Rhpn1 A G 15: 75,711,872 Q402R possibly damaging Het
Sec23b T A 2: 144,568,612 probably benign Het
Sel1l2 A T 2: 140,240,912 L602* probably null Het
Sema5b G A 16: 35,646,355 G209D probably damaging Het
Svep1 T C 4: 58,073,333 Y1992C possibly damaging Het
Syncrip T A 9: 88,456,259 probably benign Het
Synj1 G T 16: 90,967,354 A65E probably damaging Het
Taar2 G A 10: 23,941,495 R311H probably benign Het
Tecrl T C 5: 83,354,763 probably benign Het
Tenm4 G T 7: 96,777,851 G698C probably damaging Het
Tmem209 G A 6: 30,491,182 L259F probably damaging Het
Tmem247 G A 17: 86,918,503 E124K possibly damaging Het
Tnks2 C A 19: 36,852,821 A218E probably damaging Het
Tppp T A 13: 74,021,311 F57I probably damaging Het
Trim36 A G 18: 46,172,525 W452R probably damaging Het
Vars2 A T 17: 35,664,584 V262E probably damaging Het
Vmn2r92 C T 17: 18,167,957 A408V probably damaging Het
Zfp516 G T 18: 82,955,772 A32S probably benign Het
Zfy2 G T Y: 2,107,348 L429I possibly damaging Het
Other mutations in Fam160a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00708:Fam160a2 APN 7 105388260 missense probably damaging 1.00
IGL01972:Fam160a2 APN 7 105390145 missense probably damaging 0.99
IGL02054:Fam160a2 APN 7 105384423 missense probably damaging 1.00
IGL03037:Fam160a2 APN 7 105379086 missense probably benign 0.04
IGL03278:Fam160a2 APN 7 105385124 missense possibly damaging 0.93
IGL03340:Fam160a2 APN 7 105389310 missense probably damaging 1.00
IGL03374:Fam160a2 APN 7 105383951 missense probably damaging 1.00
R0482:Fam160a2 UTSW 7 105384212 missense possibly damaging 0.87
R0586:Fam160a2 UTSW 7 105389447 missense probably damaging 1.00
R0686:Fam160a2 UTSW 7 105388309 missense probably damaging 1.00
R1617:Fam160a2 UTSW 7 105385062 missense probably damaging 1.00
R2025:Fam160a2 UTSW 7 105388936 missense probably damaging 1.00
R2042:Fam160a2 UTSW 7 105384121 nonsense probably null
R2049:Fam160a2 UTSW 7 105389839 missense probably damaging 1.00
R2201:Fam160a2 UTSW 7 105388191 missense probably damaging 1.00
R3778:Fam160a2 UTSW 7 105388228 missense probably damaging 1.00
R4094:Fam160a2 UTSW 7 105388218 missense probably damaging 1.00
R4348:Fam160a2 UTSW 7 105385349 missense probably damaging 1.00
R4482:Fam160a2 UTSW 7 105389674 missense probably benign 0.06
R4609:Fam160a2 UTSW 7 105388224 missense probably damaging 1.00
R4742:Fam160a2 UTSW 7 105384311 missense probably damaging 0.99
R4977:Fam160a2 UTSW 7 105389335 missense probably damaging 1.00
R5642:Fam160a2 UTSW 7 105389882 missense probably damaging 1.00
R6404:Fam160a2 UTSW 7 105384991 nonsense probably null
R6906:Fam160a2 UTSW 7 105388269 missense probably damaging 1.00
R7053:Fam160a2 UTSW 7 105384572 missense probably damaging 1.00
R7265:Fam160a2 UTSW 7 105384225 missense probably benign 0.00
R7808:Fam160a2 UTSW 7 105384525 missense probably damaging 1.00
X0022:Fam160a2 UTSW 7 105389709 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CATCTGACAGAGCCATGAGCAGAAG -3'
(R):5'- TGCTGTGAGAAACCACACGTACC -3'

Sequencing Primer
(F):5'- CCATGAGCAGAAGTAGAGCATC -3'
(R):5'- AGGATCGAGCAGTTCCTTCAG -3'
Posted On2013-05-23