Incidental Mutation 'R5059:Arhgef38'
ID 386501
Institutional Source Beutler Lab
Gene Symbol Arhgef38
Ensembl Gene ENSMUSG00000040969
Gene Name Rho guanine nucleotide exchange factor (GEF) 38
Synonyms D630013G24Rik, 9130221D24Rik
MMRRC Submission 042649-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R5059 (G1)
Quality Score 225
Status Validated
Chromosome 3
Chromosomal Location 133112278-133234949 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 133137414 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 465 (Y465F)
Ref Sequence ENSEMBL: ENSMUSP00000114238 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054105] [ENSMUST00000147041]
AlphaFold Q80VK6
Predicted Effect probably benign
Transcript: ENSMUST00000054105
SMART Domains Protein: ENSMUSP00000054558
Gene: ENSMUSG00000040969

DomainStartEndE-ValueType
SH3 1 60 5.56e-1 SMART
low complexity region 95 106 N/A INTRINSIC
SH3 126 189 8.2e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000147041
AA Change: Y465F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000114238
Gene: ENSMUSG00000040969
AA Change: Y465F

DomainStartEndE-ValueType
low complexity region 34 49 N/A INTRINSIC
RhoGEF 98 284 2.72e-33 SMART
low complexity region 296 312 N/A INTRINSIC
BAR 315 514 4.8e-29 SMART
SH3 584 643 5.56e-1 SMART
low complexity region 678 689 N/A INTRINSIC
SH3 709 768 1.95e-10 SMART
Meta Mutation Damage Score 0.2811 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.9%
Validation Efficiency 98% (52/53)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam26b T A 8: 43,520,600 N455I probably damaging Het
Alg12 A G 15: 88,811,456 F279S probably damaging Het
Angpt4 A G 2: 151,934,440 D296G probably damaging Het
Ank1 T A 8: 23,096,188 S437T probably damaging Het
Apol7a G A 15: 77,389,812 probably benign Het
Atp8a2 T G 14: 59,691,537 T1023P probably benign Het
Cdh7 C A 1: 110,065,700 A295E probably damaging Het
Cela3b T C 4: 137,424,870 E92G probably benign Het
Cntnap5a T C 1: 116,428,494 S752P probably benign Het
Dlx2 T C 2: 71,546,241 H51R probably damaging Het
Dnm2 T C 9: 21,504,578 I736T probably damaging Het
Dst A G 1: 34,163,346 T252A possibly damaging Het
Fbxo40 T C 16: 36,970,296 R151G possibly damaging Het
Gapdhs C T 7: 30,731,985 A357T probably benign Het
Gm13101 A G 4: 143,964,995 V386A probably damaging Het
Gon4l T A 3: 88,900,012 M1671K probably benign Het
Gpi1 T C 7: 34,207,688 Y327C probably damaging Het
Gucy2g T C 19: 55,226,071 R542G probably benign Het
Hectd3 A G 4: 116,997,164 K308E possibly damaging Het
Hip1 A G 5: 135,449,821 F178S probably damaging Het
Hydin A G 8: 110,505,769 D1640G probably damaging Het
Il18r1 G A 1: 40,481,067 probably null Het
Kdm3b T C 18: 34,777,197 S23P possibly damaging Het
Lactb T C 9: 66,975,144 E83G probably benign Het
Larp4 A T 15: 100,005,290 D414V probably damaging Het
Map2k5 T C 9: 63,257,014 H336R probably benign Het
Mast4 T C 13: 102,750,563 E1006G probably damaging Het
Mbd5 T C 2: 49,256,455 S226P probably damaging Het
Micall1 A T 15: 79,122,834 probably benign Het
Mtpap T A 18: 4,375,827 probably benign Het
Olfr482 A G 7: 108,095,315 L85P probably damaging Het
Olfr608 A T 7: 103,470,281 K81* probably null Het
Pnrc1 G A 4: 33,246,072 Q296* probably null Het
Poc1a G T 9: 106,349,813 probably benign Het
Prkcsh T A 9: 22,012,750 L439Q probably damaging Het
Prkdc T C 16: 15,838,018 L3970P probably damaging Het
Ptcd1 G A 5: 145,152,224 P542L probably benign Het
Rps6ka5 G A 12: 100,554,375 T631I probably damaging Het
Rxfp1 T C 3: 79,663,312 N271S probably benign Het
Taf6 A G 5: 138,179,447 M541T probably benign Het
Tek T A 4: 94,804,314 C169S probably benign Het
Tgfbr3l T A 8: 4,249,343 probably null Het
Trpv3 A G 11: 73,295,323 N647D probably benign Het
Ube3c A G 5: 29,631,295 K638R probably null Het
Vmn1r191 G A 13: 22,178,993 A197V probably damaging Het
Vmn2r6 T C 3: 64,537,623 T894A possibly damaging Het
Vstm4 T G 14: 32,863,730 Y85D probably damaging Het
Wnt7a A G 6: 91,394,500 I160T probably benign Het
Zc3h7a TAGAGAG TAGAGAGAG 16: 11,161,121 probably null Het
Zfp988 A T 4: 147,331,915 K269* probably null Het
Other mutations in Arhgef38
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Arhgef38 APN 3 133132051 missense probably benign 0.05
IGL00533:Arhgef38 APN 3 133116459 nonsense probably null
IGL03031:Arhgef38 APN 3 133132067 missense possibly damaging 0.90
F5770:Arhgef38 UTSW 3 133149540 missense probably damaging 1.00
PIT4362001:Arhgef38 UTSW 3 133160830 missense
R0050:Arhgef38 UTSW 3 133132196 missense probably damaging 0.99
R0050:Arhgef38 UTSW 3 133132196 missense probably damaging 0.99
R0076:Arhgef38 UTSW 3 133160746 missense possibly damaging 0.52
R0515:Arhgef38 UTSW 3 133149540 missense probably damaging 1.00
R0730:Arhgef38 UTSW 3 133137471 missense probably benign 0.25
R0765:Arhgef38 UTSW 3 133116583 missense probably damaging 1.00
R1054:Arhgef38 UTSW 3 133116465 missense probably damaging 1.00
R1261:Arhgef38 UTSW 3 133160863 missense possibly damaging 0.52
R1568:Arhgef38 UTSW 3 133132464 missense probably damaging 0.98
R1580:Arhgef38 UTSW 3 133133704 missense probably benign 0.24
R1716:Arhgef38 UTSW 3 133140837 missense probably benign 0.35
R1875:Arhgef38 UTSW 3 133133740 critical splice acceptor site probably null
R2118:Arhgef38 UTSW 3 133160753 missense probably benign 0.31
R2119:Arhgef38 UTSW 3 133160753 missense probably benign 0.31
R2122:Arhgef38 UTSW 3 133160753 missense probably benign 0.31
R2417:Arhgef38 UTSW 3 133146473 missense probably damaging 1.00
R3832:Arhgef38 UTSW 3 133206925 missense possibly damaging 0.89
R4657:Arhgef38 UTSW 3 133234681 missense probably damaging 1.00
R4666:Arhgef38 UTSW 3 133140772 critical splice donor site probably null
R4732:Arhgef38 UTSW 3 133132269 nonsense probably null
R4733:Arhgef38 UTSW 3 133132269 nonsense probably null
R5108:Arhgef38 UTSW 3 133137268 missense probably benign 0.14
R5310:Arhgef38 UTSW 3 133116466 missense probably damaging 0.98
R5820:Arhgef38 UTSW 3 133160799 missense probably benign 0.44
R5987:Arhgef38 UTSW 3 133206958 missense possibly damaging 0.67
R6115:Arhgef38 UTSW 3 133132613 splice site probably null
R6313:Arhgef38 UTSW 3 133234708 missense possibly damaging 0.80
R6339:Arhgef38 UTSW 3 133133662 missense probably benign 0.35
R6356:Arhgef38 UTSW 3 133140877 missense probably benign 0.01
R6648:Arhgef38 UTSW 3 133132475 missense probably damaging 1.00
R7050:Arhgef38 UTSW 3 133133627 start gained probably benign
R7083:Arhgef38 UTSW 3 133132436 missense unknown
R7561:Arhgef38 UTSW 3 133160728 missense
R7769:Arhgef38 UTSW 3 133149622 missense unknown
R8050:Arhgef38 UTSW 3 133137562 nonsense probably null
R8471:Arhgef38 UTSW 3 133234711 missense probably damaging 1.00
R8835:Arhgef38 UTSW 3 133132071 missense unknown
R9151:Arhgef38 UTSW 3 133206945 missense
R9154:Arhgef38 UTSW 3 133132163 missense unknown
R9263:Arhgef38 UTSW 3 133160768 missense
R9367:Arhgef38 UTSW 3 133142237 missense unknown
Z1177:Arhgef38 UTSW 3 133206961 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AACATGTAGGGGCCACACATAC -3'
(R):5'- TTCTTTTGCAGGCAGCTCG -3'

Sequencing Primer
(F):5'- CCCCGAATGAGGACTAACATTGAG -3'
(R):5'- GGCAGCTCGTTCTCAGAGACTTATC -3'
Posted On 2016-06-06