Incidental Mutation 'R5059:Ube3c'
ID386508
Institutional Source Beutler Lab
Gene Symbol Ube3c
Ensembl Gene ENSMUSG00000039000
Gene Nameubiquitin protein ligase E3C
Synonyms
MMRRC Submission 042649-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5059 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location29569242-29676092 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 29631295 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 638 (K638R)
Ref Sequence ENSEMBL: ENSMUSP00000045998 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049453] [ENSMUST00000199032]
Predicted Effect probably null
Transcript: ENSMUST00000049453
AA Change: K638R

PolyPhen 2 Score 0.114 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000045998
Gene: ENSMUSG00000039000
AA Change: K638R

DomainStartEndE-ValueType
IQ 44 66 1.68e-3 SMART
low complexity region 363 376 N/A INTRINSIC
low complexity region 496 514 N/A INTRINSIC
Blast:HECTc 645 701 5e-25 BLAST
HECTc 742 1083 8.54e-178 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000199032
AA Change: K638R

PolyPhen 2 Score 0.952 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000142474
Gene: ENSMUSG00000039000
AA Change: K638R

DomainStartEndE-ValueType
IQ 44 66 8e-6 SMART
low complexity region 363 376 N/A INTRINSIC
low complexity region 496 514 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199598
Meta Mutation Damage Score 0.0978 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.9%
Validation Efficiency 98% (52/53)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam26b T A 8: 43,520,600 N455I probably damaging Het
Alg12 A G 15: 88,811,456 F279S probably damaging Het
Angpt4 A G 2: 151,934,440 D296G probably damaging Het
Ank1 T A 8: 23,096,188 S437T probably damaging Het
Apol7a G A 15: 77,389,812 probably benign Het
Arhgef38 T A 3: 133,137,414 Y465F probably damaging Het
Atp8a2 T G 14: 59,691,537 T1023P probably benign Het
Cdh7 C A 1: 110,065,700 A295E probably damaging Het
Cela3b T C 4: 137,424,870 E92G probably benign Het
Cntnap5a T C 1: 116,428,494 S752P probably benign Het
Dlx2 T C 2: 71,546,241 H51R probably damaging Het
Dnm2 T C 9: 21,504,578 I736T probably damaging Het
Dst A G 1: 34,163,346 T252A possibly damaging Het
Fbxo40 T C 16: 36,970,296 R151G possibly damaging Het
Gapdhs C T 7: 30,731,985 A357T probably benign Het
Gm13101 A G 4: 143,964,995 V386A probably damaging Het
Gon4l T A 3: 88,900,012 M1671K probably benign Het
Gpi1 T C 7: 34,207,688 Y327C probably damaging Het
Gucy2g T C 19: 55,226,071 R542G probably benign Het
Hectd3 A G 4: 116,997,164 K308E possibly damaging Het
Hip1 A G 5: 135,449,821 F178S probably damaging Het
Hydin A G 8: 110,505,769 D1640G probably damaging Het
Il18r1 G A 1: 40,481,067 probably null Het
Kdm3b T C 18: 34,777,197 S23P possibly damaging Het
Lactb T C 9: 66,975,144 E83G probably benign Het
Larp4 A T 15: 100,005,290 D414V probably damaging Het
Map2k5 T C 9: 63,257,014 H336R probably benign Het
Mast4 T C 13: 102,750,563 E1006G probably damaging Het
Mbd5 T C 2: 49,256,455 S226P probably damaging Het
Micall1 A T 15: 79,122,834 probably benign Het
Mtpap T A 18: 4,375,827 probably benign Het
Olfr482 A G 7: 108,095,315 L85P probably damaging Het
Olfr608 A T 7: 103,470,281 K81* probably null Het
Pnrc1 G A 4: 33,246,072 Q296* probably null Het
Poc1a G T 9: 106,349,813 probably benign Het
Prkcsh T A 9: 22,012,750 L439Q probably damaging Het
Prkdc T C 16: 15,838,018 L3970P probably damaging Het
Ptcd1 G A 5: 145,152,224 P542L probably benign Het
Rps6ka5 G A 12: 100,554,375 T631I probably damaging Het
Rxfp1 T C 3: 79,663,312 N271S probably benign Het
Taf6 A G 5: 138,179,447 M541T probably benign Het
Tek T A 4: 94,804,314 C169S probably benign Het
Tgfbr3l T A 8: 4,249,343 probably null Het
Trpv3 A G 11: 73,295,323 N647D probably benign Het
Vmn1r191 G A 13: 22,178,993 A197V probably damaging Het
Vmn2r6 T C 3: 64,537,623 T894A possibly damaging Het
Vstm4 T G 14: 32,863,730 Y85D probably damaging Het
Wnt7a A G 6: 91,394,500 I160T probably benign Het
Zc3h7a TAGAGAG TAGAGAGAG 16: 11,161,121 probably null Het
Zfp988 A T 4: 147,331,915 K269* probably null Het
Other mutations in Ube3c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00557:Ube3c APN 5 29619229 missense probably damaging 1.00
IGL01526:Ube3c APN 5 29667962 missense probably damaging 0.99
IGL01901:Ube3c APN 5 29668007 missense probably damaging 1.00
IGL02029:Ube3c APN 5 29619328 missense probably damaging 1.00
IGL02893:Ube3c APN 5 29632763 missense probably damaging 1.00
IGL03400:Ube3c APN 5 29601347 missense probably benign 0.00
lord_business UTSW 5 29637586 splice site probably benign
R0067:Ube3c UTSW 5 29598938 missense possibly damaging 0.94
R0067:Ube3c UTSW 5 29598938 missense possibly damaging 0.94
R0099:Ube3c UTSW 5 29607064 missense probably damaging 1.00
R0606:Ube3c UTSW 5 29590928 missense probably damaging 1.00
R0755:Ube3c UTSW 5 29637742 missense probably damaging 1.00
R0900:Ube3c UTSW 5 29601346 missense probably benign 0.00
R1624:Ube3c UTSW 5 29646619 missense probably benign 0.00
R1701:Ube3c UTSW 5 29601202 missense probably benign
R1918:Ube3c UTSW 5 29587317 missense probably damaging 1.00
R1933:Ube3c UTSW 5 29619659 missense probably damaging 0.97
R2072:Ube3c UTSW 5 29635640 missense probably benign 0.02
R2095:Ube3c UTSW 5 29668040 missense probably damaging 1.00
R2122:Ube3c UTSW 5 29619606 missense probably benign 0.14
R2962:Ube3c UTSW 5 29658418 missense possibly damaging 0.81
R3605:Ube3c UTSW 5 29598938 missense possibly damaging 0.94
R3606:Ube3c UTSW 5 29598938 missense possibly damaging 0.94
R3764:Ube3c UTSW 5 29637586 splice site probably benign
R3940:Ube3c UTSW 5 29619360 missense probably benign 0.31
R4776:Ube3c UTSW 5 29632838 critical splice donor site probably null
R4794:Ube3c UTSW 5 29597085 missense probably benign 0.06
R4924:Ube3c UTSW 5 29631271 missense possibly damaging 0.56
R5068:Ube3c UTSW 5 29601354 critical splice donor site probably null
R5140:Ube3c UTSW 5 29635711 missense probably damaging 1.00
R5849:Ube3c UTSW 5 29658409 missense probably damaging 1.00
R5890:Ube3c UTSW 5 29658292 missense possibly damaging 0.77
R5956:Ube3c UTSW 5 29599056 intron probably benign
R6035:Ube3c UTSW 5 29601163 missense probably benign 0.00
R6035:Ube3c UTSW 5 29601163 missense probably benign 0.00
R6264:Ube3c UTSW 5 29590831 missense probably damaging 1.00
R6354:Ube3c UTSW 5 29663583 missense probably damaging 0.99
R6658:Ube3c UTSW 5 29602217 missense probably damaging 1.00
R6877:Ube3c UTSW 5 29587318 missense probably benign 0.22
R7660:Ube3c UTSW 5 29619631 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CAGCCTGTTCTTGTCCCTAAAGG -3'
(R):5'- TGCTGCTGCTACATACCTTG -3'

Sequencing Primer
(F):5'- CCTAAAGGAGGCTTTTTGTCAC -3'
(R):5'- GCTGCTACATACCTTGTCCTTTGAC -3'
Posted On2016-06-06