Incidental Mutation 'R5059:Map2k5'
ID386523
Institutional Source Beutler Lab
Gene Symbol Map2k5
Ensembl Gene ENSMUSG00000058444
Gene Namemitogen-activated protein kinase kinase 5
SynonymsMEK5
MMRRC Submission 042649-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5059 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location63163768-63377902 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 63257014 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 336 (H336R)
Ref Sequence ENSEMBL: ENSMUSP00000034920 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034920]
PDB Structure Solution structure of the PB1 domain of mouse mitogen activated protein kinase kinase 5 (MAP2K5) [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000034920
AA Change: H336R

PolyPhen 2 Score 0.405 (Sensitivity: 0.89; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000034920
Gene: ENSMUSG00000058444
AA Change: H336R

DomainStartEndE-ValueType
PB1 18 97 7.59e-12 SMART
S_TKc 166 419 7.75e-71 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213604
Meta Mutation Damage Score 0.1200 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.9%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a dual specificity protein kinase that belongs to the MAP kinase kinase family. This kinase specifically interacts with and activates MAPK7/ERK5. This kinase itself can be phosphorylated and activated by MAP3K3/MEKK3, as well as by atypical protein kinase C isoforms (aPKCs). The signal cascade mediated by this kinase is involved in growth factor stimulated cell proliferation and muscle cell differentiation. Three alternatively spliced transcript variants of this gene encoding distinct isoforms have been described. [provided by RefSeq, May 2011]
PHENOTYPE: Homozygous mutants die at E10.5 and exhibit abnormal cardiac development and a decrease in proliferation and an increase in apoptosis in the heart, head, and dorsal regions of the embryo. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam26b T A 8: 43,520,600 N455I probably damaging Het
Alg12 A G 15: 88,811,456 F279S probably damaging Het
Angpt4 A G 2: 151,934,440 D296G probably damaging Het
Ank1 T A 8: 23,096,188 S437T probably damaging Het
Apol7a G A 15: 77,389,812 probably benign Het
Arhgef38 T A 3: 133,137,414 Y465F probably damaging Het
Atp8a2 T G 14: 59,691,537 T1023P probably benign Het
Cdh7 C A 1: 110,065,700 A295E probably damaging Het
Cela3b T C 4: 137,424,870 E92G probably benign Het
Cntnap5a T C 1: 116,428,494 S752P probably benign Het
Dlx2 T C 2: 71,546,241 H51R probably damaging Het
Dnm2 T C 9: 21,504,578 I736T probably damaging Het
Dst A G 1: 34,163,346 T252A possibly damaging Het
Fbxo40 T C 16: 36,970,296 R151G possibly damaging Het
Gapdhs C T 7: 30,731,985 A357T probably benign Het
Gm13101 A G 4: 143,964,995 V386A probably damaging Het
Gon4l T A 3: 88,900,012 M1671K probably benign Het
Gpi1 T C 7: 34,207,688 Y327C probably damaging Het
Gucy2g T C 19: 55,226,071 R542G probably benign Het
Hectd3 A G 4: 116,997,164 K308E possibly damaging Het
Hip1 A G 5: 135,449,821 F178S probably damaging Het
Hydin A G 8: 110,505,769 D1640G probably damaging Het
Il18r1 G A 1: 40,481,067 probably null Het
Kdm3b T C 18: 34,777,197 S23P possibly damaging Het
Lactb T C 9: 66,975,144 E83G probably benign Het
Larp4 A T 15: 100,005,290 D414V probably damaging Het
Mast4 T C 13: 102,750,563 E1006G probably damaging Het
Mbd5 T C 2: 49,256,455 S226P probably damaging Het
Micall1 A T 15: 79,122,834 probably benign Het
Mtpap T A 18: 4,375,827 probably benign Het
Olfr482 A G 7: 108,095,315 L85P probably damaging Het
Olfr608 A T 7: 103,470,281 K81* probably null Het
Pnrc1 G A 4: 33,246,072 Q296* probably null Het
Poc1a G T 9: 106,349,813 probably benign Het
Prkcsh T A 9: 22,012,750 L439Q probably damaging Het
Prkdc T C 16: 15,838,018 L3970P probably damaging Het
Ptcd1 G A 5: 145,152,224 P542L probably benign Het
Rps6ka5 G A 12: 100,554,375 T631I probably damaging Het
Rxfp1 T C 3: 79,663,312 N271S probably benign Het
Taf6 A G 5: 138,179,447 M541T probably benign Het
Tek T A 4: 94,804,314 C169S probably benign Het
Tgfbr3l T A 8: 4,249,343 probably null Het
Trpv3 A G 11: 73,295,323 N647D probably benign Het
Ube3c A G 5: 29,631,295 K638R probably null Het
Vmn1r191 G A 13: 22,178,993 A197V probably damaging Het
Vmn2r6 T C 3: 64,537,623 T894A possibly damaging Het
Vstm4 T G 14: 32,863,730 Y85D probably damaging Het
Wnt7a A G 6: 91,394,500 I160T probably benign Het
Zc3h7a TAGAGAG TAGAGAGAG 16: 11,161,121 probably null Het
Zfp988 A T 4: 147,331,915 K269* probably null Het
Other mutations in Map2k5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00780:Map2k5 APN 9 63281077 splice site probably benign
IGL01412:Map2k5 APN 9 63293706 missense probably damaging 1.00
IGL01766:Map2k5 APN 9 63377227 missense probably benign
IGL02246:Map2k5 APN 9 63377129 missense probably benign 0.10
IGL02270:Map2k5 APN 9 63322197 splice site probably null
IGL02793:Map2k5 APN 9 63257039 missense probably benign 0.32
IGL03236:Map2k5 APN 9 63286392 splice site probably benign
R0007:Map2k5 UTSW 9 63293724 missense probably damaging 1.00
R0217:Map2k5 UTSW 9 63256975 critical splice donor site probably null
R0315:Map2k5 UTSW 9 63303151 missense probably damaging 1.00
R0801:Map2k5 UTSW 9 63357979 splice site probably benign
R1122:Map2k5 UTSW 9 63263163 missense probably damaging 1.00
R1822:Map2k5 UTSW 9 63235303 missense possibly damaging 0.79
R4308:Map2k5 UTSW 9 63235304 missense probably benign 0.02
R4421:Map2k5 UTSW 9 63164130 missense probably damaging 0.96
R4720:Map2k5 UTSW 9 63293719 missense probably damaging 1.00
R4869:Map2k5 UTSW 9 63322243 nonsense probably null
R5138:Map2k5 UTSW 9 63263158 missense probably damaging 0.99
R6005:Map2k5 UTSW 9 63281019 missense probably damaging 1.00
R6258:Map2k5 UTSW 9 63217365 missense probably benign 0.16
R6261:Map2k5 UTSW 9 63338098 missense probably benign 0.00
R6498:Map2k5 UTSW 9 63286401 missense possibly damaging 0.74
R6808:Map2k5 UTSW 9 63322246 missense probably benign 0.00
R7228:Map2k5 UTSW 9 63358022 missense probably damaging 1.00
R7819:Map2k5 UTSW 9 63358018 missense probably damaging 0.99
R8017:Map2k5 UTSW 9 63339121 missense probably damaging 0.98
R8053:Map2k5 UTSW 9 63343425 missense probably benign 0.16
R8247:Map2k5 UTSW 9 63371737 missense probably damaging 1.00
R8309:Map2k5 UTSW 9 63339079 critical splice donor site probably null
R8341:Map2k5 UTSW 9 63339098 missense probably damaging 1.00
Z1176:Map2k5 UTSW 9 63358038 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGTCTGCTGAGTCAGACGAC -3'
(R):5'- TCTATGACTGTGTGCAGGATTCTC -3'

Sequencing Primer
(F):5'- TCTGCTGAGTCAGACGACATACATG -3'
(R):5'- TGCAGGATTCTCTGTTGCTTC -3'
Posted On2016-06-06