Incidental Mutation 'R5059:Vmn1r191'
ID386527
Institutional Source Beutler Lab
Gene Symbol Vmn1r191
Ensembl Gene ENSMUSG00000095916
Gene Namevomeronasal 1 receptor 191
SynonymsV1rh15
MMRRC Submission 042649-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.153) question?
Stock #R5059 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location22178686-22179582 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 22178993 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 197 (A197V)
Ref Sequence ENSEMBL: ENSMUSP00000072206 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072369]
Predicted Effect probably damaging
Transcript: ENSMUST00000072369
AA Change: A197V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000072206
Gene: ENSMUSG00000095916
AA Change: A197V

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
Pfam:V1R 35 291 4.4e-33 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000120067
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.9%
Validation Efficiency 98% (52/53)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam26b T A 8: 43,520,600 N455I probably damaging Het
Alg12 A G 15: 88,811,456 F279S probably damaging Het
Angpt4 A G 2: 151,934,440 D296G probably damaging Het
Ank1 T A 8: 23,096,188 S437T probably damaging Het
Apol7a G A 15: 77,389,812 probably benign Het
Arhgef38 T A 3: 133,137,414 Y465F probably damaging Het
Atp8a2 T G 14: 59,691,537 T1023P probably benign Het
Cdh7 C A 1: 110,065,700 A295E probably damaging Het
Cela3b T C 4: 137,424,870 E92G probably benign Het
Cntnap5a T C 1: 116,428,494 S752P probably benign Het
Dlx2 T C 2: 71,546,241 H51R probably damaging Het
Dnm2 T C 9: 21,504,578 I736T probably damaging Het
Dst A G 1: 34,163,346 T252A possibly damaging Het
Fbxo40 T C 16: 36,970,296 R151G possibly damaging Het
Gapdhs C T 7: 30,731,985 A357T probably benign Het
Gm13101 A G 4: 143,964,995 V386A probably damaging Het
Gon4l T A 3: 88,900,012 M1671K probably benign Het
Gpi1 T C 7: 34,207,688 Y327C probably damaging Het
Gucy2g T C 19: 55,226,071 R542G probably benign Het
Hectd3 A G 4: 116,997,164 K308E possibly damaging Het
Hip1 A G 5: 135,449,821 F178S probably damaging Het
Hydin A G 8: 110,505,769 D1640G probably damaging Het
Il18r1 G A 1: 40,481,067 probably null Het
Kdm3b T C 18: 34,777,197 S23P possibly damaging Het
Lactb T C 9: 66,975,144 E83G probably benign Het
Larp4 A T 15: 100,005,290 D414V probably damaging Het
Map2k5 T C 9: 63,257,014 H336R probably benign Het
Mast4 T C 13: 102,750,563 E1006G probably damaging Het
Mbd5 T C 2: 49,256,455 S226P probably damaging Het
Micall1 A T 15: 79,122,834 probably benign Het
Mtpap T A 18: 4,375,827 probably benign Het
Olfr482 A G 7: 108,095,315 L85P probably damaging Het
Olfr608 A T 7: 103,470,281 K81* probably null Het
Pnrc1 G A 4: 33,246,072 Q296* probably null Het
Poc1a G T 9: 106,349,813 probably benign Het
Prkcsh T A 9: 22,012,750 L439Q probably damaging Het
Prkdc T C 16: 15,838,018 L3970P probably damaging Het
Ptcd1 G A 5: 145,152,224 P542L probably benign Het
Rps6ka5 G A 12: 100,554,375 T631I probably damaging Het
Rxfp1 T C 3: 79,663,312 N271S probably benign Het
Taf6 A G 5: 138,179,447 M541T probably benign Het
Tek T A 4: 94,804,314 C169S probably benign Het
Tgfbr3l T A 8: 4,249,343 probably null Het
Trpv3 A G 11: 73,295,323 N647D probably benign Het
Ube3c A G 5: 29,631,295 K638R probably null Het
Vmn2r6 T C 3: 64,537,623 T894A possibly damaging Het
Vstm4 T G 14: 32,863,730 Y85D probably damaging Het
Wnt7a A G 6: 91,394,500 I160T probably benign Het
Zc3h7a TAGAGAG TAGAGAGAG 16: 11,161,121 probably null Het
Zfp988 A T 4: 147,331,915 K269* probably null Het
Other mutations in Vmn1r191
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00233:Vmn1r191 APN 13 22178720 missense probably damaging 1.00
IGL01645:Vmn1r191 APN 13 22179444 missense probably benign 0.03
IGL02224:Vmn1r191 APN 13 22178898 missense probably damaging 1.00
IGL02321:Vmn1r191 APN 13 22178898 nonsense probably null
IGL02516:Vmn1r191 APN 13 22179540 missense probably benign 0.38
IGL02602:Vmn1r191 APN 13 22179465 missense probably damaging 1.00
IGL02630:Vmn1r191 APN 13 22179261 missense possibly damaging 0.95
IGL03077:Vmn1r191 APN 13 22179146 missense probably benign 0.07
IGL03380:Vmn1r191 APN 13 22178885 missense probably damaging 0.99
R0571:Vmn1r191 UTSW 13 22179047 missense probably damaging 0.96
R0981:Vmn1r191 UTSW 13 22179219 missense probably benign 0.00
R1672:Vmn1r191 UTSW 13 22179092 missense probably benign 0.01
R1955:Vmn1r191 UTSW 13 22178815 missense possibly damaging 0.79
R1969:Vmn1r191 UTSW 13 22178782 missense possibly damaging 0.71
R6484:Vmn1r191 UTSW 13 22178748 missense probably benign 0.00
R6736:Vmn1r191 UTSW 13 22179550 missense probably benign 0.14
R7063:Vmn1r191 UTSW 13 22178694 missense probably benign 0.08
R7475:Vmn1r191 UTSW 13 22178772 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGAGAAAAGGCACAATCTGTCC -3'
(R):5'- CATCAGTCCCAGAGCATCTG -3'

Sequencing Primer
(F):5'- AAGGCACAATCTGTCCAGTAG -3'
(R):5'- TCAGGCCAACGTCTGCATG -3'
Posted On2016-06-06