Incidental Mutation 'R5060:Pax7'
ID386555
Institutional Source Beutler Lab
Gene Symbol Pax7
Ensembl Gene ENSMUSG00000028736
Gene Namepaired box 7
SynonymsPax-7
MMRRC Submission 042650-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5060 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location139737062-139833528 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 139829595 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 118 (I118N)
Ref Sequence ENSEMBL: ENSMUSP00000133536 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030508] [ENSMUST00000174681]
Predicted Effect probably damaging
Transcript: ENSMUST00000030508
AA Change: I118N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000030508
Gene: ENSMUSG00000028736
AA Change: I118N

DomainStartEndE-ValueType
PAX 34 159 2.07e-89 SMART
low complexity region 163 181 N/A INTRINSIC
HOX 215 277 1.46e-28 SMART
Pfam:Pax7 342 383 1.1e-23 PFAM
low complexity region 413 427 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000174681
AA Change: I118N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000133536
Gene: ENSMUSG00000028736
AA Change: I118N

DomainStartEndE-ValueType
PAX 34 161 1.3e-86 SMART
low complexity region 165 183 N/A INTRINSIC
HOX 217 279 1.46e-28 SMART
Pfam:Pax7 345 385 1.3e-22 PFAM
low complexity region 415 429 N/A INTRINSIC
Meta Mutation Damage Score 0.9611 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 92.9%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the paired box (PAX) family of transcription factors. Members of this gene family typically contain a paired box domain, an octapeptide, and a paired-type homeodomain. These genes play critical roles during fetal development and cancer growth. The specific function of the paired box 7 gene is unknown but speculated to involve tumor suppression since fusion of this gene with a forkhead domain family member has been associated with alveolar rhabdomyosarcoma. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2008]
PHENOTYPE: Mice homozygous for a targeted null mutation exhibit craniofacial malformations involving the nose and maxilla, and die within three weeks after birth. Mice homozygous for floxed alleles activated in muscle cells exhibit reduced satellite cell numbers and impaired muscle regeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A530064D06Rik A T 17: 48,166,939 L17Q probably damaging Het
Abca6 A G 11: 110,219,604 V573A possibly damaging Het
Abcc9 A G 6: 142,626,110 probably benign Het
Actg1 A G 11: 120,347,013 S234P probably benign Het
Acvr2a A G 2: 48,890,299 D177G probably damaging Het
Adamts12 T C 15: 11,299,968 C914R probably damaging Het
Adprhl1 A G 8: 13,248,621 I103T possibly damaging Het
Als2cl C T 9: 110,884,137 L32F probably damaging Het
Ank2 T C 3: 126,945,921 probably benign Het
Ankrd52 T A 10: 128,389,841 S959R possibly damaging Het
Bnc2 C A 4: 84,531,635 A122S probably benign Het
Cfap54 C T 10: 93,039,151 V443M probably damaging Het
Clca4b T A 3: 144,911,506 R794S probably damaging Het
Col4a3bp A T 13: 96,603,155 K226N probably benign Het
Cyp2c65 T C 19: 39,061,070 L14P unknown Het
Ggt5 T C 10: 75,604,774 M243T probably benign Het
Gmds A G 13: 31,940,499 I292T probably benign Het
Gpcpd1 A T 2: 132,544,435 V341E probably damaging Het
Grm3 A G 5: 9,570,167 F359S probably damaging Het
Hcn1 A T 13: 117,873,905 K340* probably null Het
Heatr9 T C 11: 83,512,432 E427G probably benign Het
Ick C T 9: 78,153,696 T208I probably benign Het
Kif26b G A 1: 178,530,630 G102D unknown Het
Mark3 T C 12: 111,618,326 F119L probably damaging Het
Melk T C 4: 44,350,959 V500A probably benign Het
Mrpl41 A G 2: 24,974,283 F126L probably damaging Het
Olfr803 C T 10: 129,691,830 M70I probably benign Het
Olfr95 C A 17: 37,211,416 A146S probably benign Het
Plcl1 G T 1: 55,696,512 M337I possibly damaging Het
Poc1a G T 9: 106,349,813 probably benign Het
Rabgef1 A G 5: 130,212,003 Y321C probably damaging Het
Rhobtb3 A C 13: 75,913,270 L252R probably benign Het
Rlf A G 4: 121,146,866 V1639A probably benign Het
Tff1 A G 17: 31,162,708 V65A probably damaging Het
Trpm4 G T 7: 45,321,834 D222E probably damaging Het
Ttn A T 2: 76,813,397 D13162E probably damaging Het
Unc5d A T 8: 28,719,695 S466T probably benign Het
Vmn1r73 A G 7: 11,756,756 Y167C probably damaging Het
Vwde C T 6: 13,208,324 probably null Het
Xpr1 T C 1: 155,328,684 probably null Het
Zbtb40 A G 4: 137,001,293 V413A possibly damaging Het
Other mutations in Pax7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02234:Pax7 APN 4 139828590 missense probably damaging 0.97
IGL03005:Pax7 APN 4 139828696 missense probably damaging 1.00
IGL03143:Pax7 APN 4 139829487 splice site probably benign
R0266:Pax7 UTSW 4 139779736 missense possibly damaging 0.79
R1843:Pax7 UTSW 4 139784491 missense probably damaging 1.00
R1891:Pax7 UTSW 4 139784626 missense probably damaging 1.00
R2847:Pax7 UTSW 4 139779643 missense possibly damaging 0.90
R2909:Pax7 UTSW 4 139828696 missense possibly damaging 0.62
R3912:Pax7 UTSW 4 139780898 missense probably benign 0.41
R4516:Pax7 UTSW 4 139780793 missense probably benign 0.00
R5060:Pax7 UTSW 4 139779617 missense probably benign 0.00
R5089:Pax7 UTSW 4 139830265 missense probably damaging 0.98
R5809:Pax7 UTSW 4 139830371 missense probably damaging 1.00
R7367:Pax7 UTSW 4 139779749 missense probably benign 0.04
R7485:Pax7 UTSW 4 139784569 missense probably benign 0.36
R7823:Pax7 UTSW 4 139740839 missense probably benign 0.20
Z1177:Pax7 UTSW 4 139784491 missense probably damaging 0.98
Z1177:Pax7 UTSW 4 139784515 missense probably benign 0.19
Predicted Primers PCR Primer
(F):5'- AGGCCTACCCTCTGAATCTC -3'
(R):5'- CATTGCCTGAGATGATGGGG -3'

Sequencing Primer
(F):5'- TGAATCTCCATCGAGGTGCCTG -3'
(R):5'- CCACTGATGTCATTCTGGGAAC -3'
Posted On2016-06-06