Incidental Mutation 'R0426:Ddx39'
ID38656
Institutional Source Beutler Lab
Gene Symbol Ddx39
Ensembl Gene ENSMUSG00000005481
Gene NameDEAD (Asp-Glu-Ala-Asp) box polypeptide 39
Synonyms2610307C23Rik, BAT1
MMRRC Submission 038628-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.948) question?
Stock #R0426 (G1)
Quality Score224
Status Validated
Chromosome8
Chromosomal Location83715177-83726892 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 83721769 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 217 (T217A)
Ref Sequence ENSEMBL: ENSMUSP00000148329 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002964] [ENSMUST00000019576] [ENSMUST00000075843] [ENSMUST00000109802] [ENSMUST00000109810] [ENSMUST00000140521] [ENSMUST00000166939] [ENSMUST00000172396] [ENSMUST00000212949]
Predicted Effect probably benign
Transcript: ENSMUST00000002964
SMART Domains Protein: ENSMUSP00000002964
Gene: ENSMUSG00000002885

DomainStartEndE-ValueType
EGF 30 68 1.63e1 SMART
EGF_CA 69 119 5.92e-8 SMART
EGF_CA 120 167 1.78e-11 SMART
GPS 384 430 2.18e-8 SMART
Pfam:Dicty_CAR 431 703 1.3e-8 PFAM
Pfam:7tm_2 432 672 8.1e-68 PFAM
low complexity region 704 714 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000019576
AA Change: T217A

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000019576
Gene: ENSMUSG00000005481
AA Change: T217A

DomainStartEndE-ValueType
low complexity region 5 18 N/A INTRINSIC
DEXDc 63 264 4.06e-54 SMART
HELICc 300 381 9.09e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000075843
SMART Domains Protein: ENSMUSP00000075240
Gene: ENSMUSG00000002885

DomainStartEndE-ValueType
EGF 30 68 1.63e1 SMART
EGF_CA 69 119 5.92e-8 SMART
EGF_CA 165 213 1.38e-8 SMART
EGF_CA 214 261 1.78e-11 SMART
GPS 478 524 2.18e-8 SMART
Pfam:Dicty_CAR 525 798 4.6e-8 PFAM
Pfam:7tm_2 526 766 5.3e-68 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109802
SMART Domains Protein: ENSMUSP00000105427
Gene: ENSMUSG00000002885

DomainStartEndE-ValueType
EGF 30 68 1.63e1 SMART
EGF_CA 69 119 5.92e-8 SMART
EGF_CA 120 168 1.38e-8 SMART
EGF_CA 169 216 1.78e-11 SMART
GPS 433 479 2.18e-8 SMART
Pfam:Dicty_CAR 480 752 5.3e-8 PFAM
Pfam:7tm_2 481 721 7.5e-67 PFAM
low complexity region 753 763 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109810
AA Change: T217A

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000105435
Gene: ENSMUSG00000005481
AA Change: T217A

DomainStartEndE-ValueType
low complexity region 5 18 N/A INTRINSIC
DEXDc 63 264 4.06e-54 SMART
HELICc 300 381 9.09e-25 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127505
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138789
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139797
Predicted Effect probably benign
Transcript: ENSMUST00000140521
SMART Domains Protein: ENSMUSP00000116101
Gene: ENSMUSG00000005481

DomainStartEndE-ValueType
low complexity region 5 18 N/A INTRINSIC
DEXDc 63 208 2.82e-21 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140606
Predicted Effect probably benign
Transcript: ENSMUST00000166939
SMART Domains Protein: ENSMUSP00000128220
Gene: ENSMUSG00000002885

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
EGF 28 66 1.63e1 SMART
EGF_CA 67 117 5.92e-8 SMART
EGF_CA 118 165 1.78e-11 SMART
GPS 382 428 2.18e-8 SMART
Pfam:Dicty_CAR 429 701 2.1e-7 PFAM
Pfam:7tm_2 430 670 1.7e-66 PFAM
low complexity region 702 712 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172396
AA Change: T217A

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000132222
Gene: ENSMUSG00000005481
AA Change: T217A

DomainStartEndE-ValueType
low complexity region 5 18 N/A INTRINSIC
DEXDc 63 264 4.06e-54 SMART
HELICc 300 381 9.09e-25 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184114
Predicted Effect probably benign
Transcript: ENSMUST00000212949
AA Change: T217A

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
Meta Mutation Damage Score 0.2331 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.9%
Validation Efficiency 96% (86/90)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the DEAD box protein family. These proteins are characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD) and are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure, such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of the DEAD box protein family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. This gene is thought to play a role in the prognosis of patients with gastrointestinal stromal tumors. A pseudogene of this gene is present on chromosome 13. Alternate splicing results in multiple transcript variants. Additional alternatively spliced transcript variants of this gene have been described, but their full-length nature is not known. [provided by RefSeq, Sep 2013]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830010M20Rik C T 5: 107,510,373 T1603I probably damaging Het
Abca8b G T 11: 109,955,027 probably benign Het
Acadl A T 1: 66,841,646 F320L probably damaging Het
Acsbg1 T C 9: 54,622,746 D222G probably benign Het
Anapc15 A G 7: 101,898,033 T39A probably benign Het
Ano3 A T 2: 110,661,174 V919E probably damaging Het
Arhgef12 T C 9: 42,970,990 probably null Het
Atad5 T A 11: 80,112,832 I1091N probably benign Het
Atf1 A T 15: 100,232,827 H26L possibly damaging Het
Atp10a T C 7: 58,784,734 M252T probably benign Het
Cd55 C T 1: 130,448,372 R347H probably benign Het
Cdc27 A C 11: 104,513,027 probably null Het
Cdh9 G A 15: 16,823,454 probably null Het
Cdk11b T C 4: 155,642,512 probably benign Het
Cep70 A G 9: 99,297,684 D567G probably benign Het
Cep78 A T 19: 15,970,970 Y382* probably null Het
Col9a2 T C 4: 121,044,660 probably benign Het
Cyp2d12 G A 15: 82,558,963 D409N probably benign Het
Dennd1b T A 1: 139,170,196 D733E probably benign Het
Dicer1 A G 12: 104,702,542 S1294P probably damaging Het
Dnah3 T C 7: 119,943,572 E3539G probably benign Het
Dnmbp A G 19: 43,852,436 probably benign Het
Dysf T C 6: 84,149,757 L1332P probably damaging Het
F5 A G 1: 164,182,840 D380G probably damaging Het
Fam160a2 A C 7: 105,389,473 C186W probably damaging Het
Fam171a1 T C 2: 3,225,396 V522A probably benign Het
Galr2 C A 11: 116,281,691 A69D probably damaging Het
Grk2 T C 19: 4,290,600 probably null Het
Gtf3c1 A T 7: 125,663,016 Y1119* probably null Het
Hgd A T 16: 37,588,685 probably benign Het
Ildr2 G T 1: 166,308,899 V436L probably benign Het
Intu G A 3: 40,675,305 C355Y probably damaging Het
Irf2bpl G T 12: 86,883,096 P268T probably benign Het
Jarid2 T C 13: 44,840,882 probably null Het
Jup A T 11: 100,372,401 M716K probably benign Het
Kank1 G A 19: 25,411,473 V809I probably damaging Het
Kdm1b T A 13: 47,064,244 probably benign Het
Kdm3a C T 6: 71,600,755 C687Y probably damaging Het
Kdm5d T A Y: 942,437 probably benign Het
Kifap3 T A 1: 163,865,552 probably benign Het
Macf1 T A 4: 123,483,660 K1400* probably null Het
Majin A G 19: 6,212,117 probably benign Het
Mb21d1 G A 9: 78,435,738 probably benign Het
Mctp1 A G 13: 77,020,821 I846V probably benign Het
Mrgpra2b T A 7: 47,464,127 I286F possibly damaging Het
Neil3 T G 8: 53,609,396 probably benign Het
Nox3 G T 17: 3,695,563 N23K probably damaging Het
Nt5c3 T C 6: 56,883,812 K219E probably benign Het
Olfr1458 G A 19: 13,103,278 R3C possibly damaging Het
Olfr213 A T 6: 116,540,485 N11Y probably damaging Het
Olfr389 T A 11: 73,776,437 M297L probably benign Het
Olfr524 A C 7: 140,202,116 F218C possibly damaging Het
Olfr548-ps1 T A 7: 102,542,686 I250N probably damaging Het
Olfr954 T C 9: 39,461,593 L54P probably damaging Het
Pacsin2 A G 15: 83,379,795 V347A possibly damaging Het
Pcdhb7 A T 18: 37,342,804 E331V probably damaging Het
Pcid2 A C 8: 13,081,262 probably null Het
Pcsk9 T C 4: 106,450,077 D323G possibly damaging Het
Pdhb T C 14: 8,169,801 E203G probably damaging Het
Phlpp2 A G 8: 109,928,463 Y630C probably benign Het
Pidd1 C T 7: 141,439,133 A812T probably damaging Het
Plau G A 14: 20,842,314 R389H probably benign Het
Plekhg6 G A 6: 125,364,629 probably null Het
Ppox T C 1: 171,277,749 Y321C probably damaging Het
Pxdn A G 12: 29,987,066 N281S possibly damaging Het
Pycrl A T 15: 75,918,388 M138K probably benign Het
Radil T C 5: 142,497,873 Y526C probably damaging Het
Ranbp3 C A 17: 56,707,169 D233E probably benign Het
Rhpn1 A G 15: 75,711,872 Q402R possibly damaging Het
Sec23b T A 2: 144,568,612 probably benign Het
Sel1l2 A T 2: 140,240,912 L602* probably null Het
Sema5b G A 16: 35,646,355 G209D probably damaging Het
Svep1 T C 4: 58,073,333 Y1992C possibly damaging Het
Syncrip T A 9: 88,456,259 probably benign Het
Synj1 G T 16: 90,967,354 A65E probably damaging Het
Taar2 G A 10: 23,941,495 R311H probably benign Het
Tecrl T C 5: 83,354,763 probably benign Het
Tenm4 G T 7: 96,777,851 G698C probably damaging Het
Tmem209 G A 6: 30,491,182 L259F probably damaging Het
Tmem247 G A 17: 86,918,503 E124K possibly damaging Het
Tnks2 C A 19: 36,852,821 A218E probably damaging Het
Tppp T A 13: 74,021,311 F57I probably damaging Het
Trim36 A G 18: 46,172,525 W452R probably damaging Het
Vars2 A T 17: 35,664,584 V262E probably damaging Het
Vmn2r92 C T 17: 18,167,957 A408V probably damaging Het
Zfp516 G T 18: 82,955,772 A32S probably benign Het
Zfy2 G T Y: 2,107,348 L429I possibly damaging Het
Other mutations in Ddx39
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02544:Ddx39 APN 8 83722773 missense probably benign 0.03
IGL02712:Ddx39 APN 8 83721757 missense probably benign 0.03
R0038:Ddx39 UTSW 8 83722498 missense probably damaging 1.00
R0038:Ddx39 UTSW 8 83722498 missense probably damaging 1.00
R0051:Ddx39 UTSW 8 83720622 missense possibly damaging 0.83
R0051:Ddx39 UTSW 8 83720622 missense possibly damaging 0.83
R0143:Ddx39 UTSW 8 83720550 missense probably benign 0.22
R0147:Ddx39 UTSW 8 83722476 missense possibly damaging 0.74
R0148:Ddx39 UTSW 8 83722476 missense possibly damaging 0.74
R0392:Ddx39 UTSW 8 83721737 missense probably damaging 0.97
R0830:Ddx39 UTSW 8 83719823 missense possibly damaging 0.47
R1509:Ddx39 UTSW 8 83719898 missense probably damaging 1.00
R2935:Ddx39 UTSW 8 83720958 missense possibly damaging 0.57
R3082:Ddx39 UTSW 8 83722706 missense possibly damaging 0.57
R4050:Ddx39 UTSW 8 83722234 missense probably benign 0.00
R4647:Ddx39 UTSW 8 83722273 missense probably benign 0.00
R4804:Ddx39 UTSW 8 83721095 missense probably damaging 0.99
R5242:Ddx39 UTSW 8 83721811 missense probably benign 0.01
R5268:Ddx39 UTSW 8 83722321 missense probably benign 0.08
R6598:Ddx39 UTSW 8 83722927 missense probably benign 0.03
R6805:Ddx39 UTSW 8 83723137 missense probably damaging 1.00
R6852:Ddx39 UTSW 8 83723017 missense probably benign 0.03
R7326:Ddx39 UTSW 8 83722471 missense probably benign 0.31
R7559:Ddx39 UTSW 8 83720966 missense possibly damaging 0.82
R7803:Ddx39 UTSW 8 83719600 critical splice donor site probably null
X0026:Ddx39 UTSW 8 83722330 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TTTCCTGAAGCGTGGCTCAAGG -3'
(R):5'- AAAGCCGGATGTAAGCTCTGCCTC -3'

Sequencing Primer
(F):5'- AGTAAGTGGACCGCAGCTC -3'
(R):5'- TCAGGTGTGGACCACTCAG -3'
Posted On2013-05-23