Mutagenetix > Incidental Mutations

Incidental Mutation 'R5060:Adprhl1'

386563

Institutional Source

Beutler Lab

Gene Symbol

Adprhl1

Ensembl Gene

ENSMUSG00000031448

Gene Name

ADP-ribosylhydrolase like 1

Synonyms

Arh2, D330008N11Rik

MMRRC Submission

042650-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5060 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

13221663-13254162 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 13248621 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 103 (I103T)

Ref Sequence

ENSEMBL: ENSMUSP00000145145 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000033825] [ENSMUST00000168498] [ENSMUST00000171619] [ENSMUST00000204916]

Predicted Effect

probably benign
Transcript: ENSMUST00000033825
AA Change: I103T

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)

SMART Domains

Protein: ENSMUSP00000033825
Gene: ENSMUSG00000031448
AA Change: I103T

Domain	Start	End	E-Value	Type
Pfam:ADP_ribosyl_GH	6	327	1.2e-53	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000168498

SMART Domains

Protein: ENSMUSP00000131920
Gene: ENSMUSG00000031448

Domain	Start	End	E-Value	Type
Pfam:ADP_ribosyl_GH	69	196	9e-17	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000171619
AA Change: I22T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000132014
Gene: ENSMUSG00000031448
AA Change: I22T

Domain	Start	End	E-Value	Type
Pfam:ADP_ribosyl_GH	1	135	4.9e-18	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000204916
AA Change: I103T

PolyPhen 2 Score 0.626 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000145145
Gene: ENSMUSG00000031448
AA Change: I103T

Domain	Start	End	E-Value	Type
Pfam:ADP_ribosyl_GH	6	327	4.2e-49	PFAM
low complexity region	509	527	N/A	INTRINSIC
low complexity region	955	969	N/A	INTRINSIC
internal_repeat_1	1047	1150	1.82e-5	PROSPERO
internal_repeat_1	1157	1274	1.82e-5	PROSPERO
low complexity region	1275	1290	N/A	INTRINSIC

Meta Mutation Damage Score

0.1031

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.5%
20x: 92.9%

Validation Efficiency

98% (52/53)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] ADP-ribosylation is a reversible posttranslational modification used to regulate protein function. ADP-ribosyltransferases (see ART1; MIM 601625) transfer ADP-ribose from NAD+ to the target protein, and ADP-ribosylhydrolases, such as ADPRHL1, reverse the reaction (Glowacki et al., 2002 [PubMed 12070318]).[supplied by OMIM, Mar 2008]

Allele List at MGI

Other mutations in this stock

Total: 42 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A530064D06Rik	A	T	17: 48,166,939	L17Q	probably damaging	Het
Abca6	A	G	11: 110,219,604	V573A	possibly damaging	Het
Abcc9	A	G	6: 142,626,110		probably benign	Het
Actg1	A	G	11: 120,347,013	S234P	probably benign	Het
Acvr2a	A	G	2: 48,890,299	D177G	probably damaging	Het
Adamts12	T	C	15: 11,299,968	C914R	probably damaging	Het
Als2cl	C	T	9: 110,884,137	L32F	probably damaging	Het
Ank2	T	C	3: 126,945,921		probably benign	Het
Ankrd52	T	A	10: 128,389,841	S959R	possibly damaging	Het
Bnc2	C	A	4: 84,531,635	A122S	probably benign	Het
Cfap54	C	T	10: 93,039,151	V443M	probably damaging	Het
Clca4b	T	A	3: 144,911,506	R794S	probably damaging	Het
Col4a3bp	A	T	13: 96,603,155	K226N	probably benign	Het
Cyp2c65	T	C	19: 39,061,070	L14P	unknown	Het
Ggt5	T	C	10: 75,604,774	M243T	probably benign	Het
Gmds	A	G	13: 31,940,499	I292T	probably benign	Het
Gpcpd1	A	T	2: 132,544,435	V341E	probably damaging	Het
Grm3	A	G	5: 9,570,167	F359S	probably damaging	Het
Hcn1	A	T	13: 117,873,905	K340*	probably null	Het
Heatr9	T	C	11: 83,512,432	E427G	probably benign	Het
Ick	C	T	9: 78,153,696	T208I	probably benign	Het
Kif26b	G	A	1: 178,530,630	G102D	unknown	Het
Mark3	T	C	12: 111,618,326	F119L	probably damaging	Het
Melk	T	C	4: 44,350,959	V500A	probably benign	Het
Mrpl41	A	G	2: 24,974,283	F126L	probably damaging	Het
Olfr803	C	T	10: 129,691,830	M70I	probably benign	Het
Olfr95	C	A	17: 37,211,416	A146S	probably benign	Het
Pax7	A	T	4: 139,779,617	S372T	probably benign	Het
Pax7	A	T	4: 139,829,595	I118N	probably damaging	Het
Plcl1	G	T	1: 55,696,512	M337I	possibly damaging	Het
Poc1a	G	T	9: 106,349,813		probably benign	Het
Rabgef1	A	G	5: 130,212,003	Y321C	probably damaging	Het
Rhobtb3	A	C	13: 75,913,270	L252R	probably benign	Het
Rlf	A	G	4: 121,146,866	V1639A	probably benign	Het
Tff1	A	G	17: 31,162,708	V65A	probably damaging	Het
Trpm4	G	T	7: 45,321,834	D222E	probably damaging	Het
Ttn	A	T	2: 76,813,397	D13162E	probably damaging	Het
Unc5d	A	T	8: 28,719,695	S466T	probably benign	Het
Vmn1r73	A	G	7: 11,756,756	Y167C	probably damaging	Het
Vwde	C	T	6: 13,208,324		probably null	Het
Xpr1	T	C	1: 155,328,684		probably null	Het
Zbtb40	A	G	4: 137,001,293	V413A	possibly damaging	Het

Other mutations in Adprhl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL03268:Adprhl1	APN	8	13246170	splice site	probably benign
BB003:Adprhl1	UTSW	8	13248682	missense	probably damaging	1.00
BB004:Adprhl1	UTSW	8	13248682	missense	probably damaging	1.00
BB005:Adprhl1	UTSW	8	13248682	missense	probably damaging	1.00
BB006:Adprhl1	UTSW	8	13248682	missense	probably damaging	1.00
BB013:Adprhl1	UTSW	8	13248682	missense	probably damaging	1.00
BB014:Adprhl1	UTSW	8	13248682	missense	probably damaging	1.00
BB015:Adprhl1	UTSW	8	13248682	missense	probably damaging	1.00
BB016:Adprhl1	UTSW	8	13248682	missense	probably damaging	1.00
R0244:Adprhl1	UTSW	8	13242391	splice site	probably benign
R0636:Adprhl1	UTSW	8	13248702	missense	probably damaging	1.00
R1295:Adprhl1	UTSW	8	13248624	missense	probably damaging	1.00
R2111:Adprhl1	UTSW	8	13248694	missense	probably damaging	1.00
R2112:Adprhl1	UTSW	8	13248694	missense	probably damaging	1.00
R2184:Adprhl1	UTSW	8	13242559	missense	probably benign	0.00
R4411:Adprhl1	UTSW	8	13246114	missense	probably benign	0.16
R4412:Adprhl1	UTSW	8	13246114	missense	probably benign	0.16
R4413:Adprhl1	UTSW	8	13246114	missense	probably benign	0.16
R4615:Adprhl1	UTSW	8	13242250	critical splice donor site	probably null
R4618:Adprhl1	UTSW	8	13242250	critical splice donor site	probably null
R5016:Adprhl1	UTSW	8	13224889	missense	possibly damaging	0.88
R5058:Adprhl1	UTSW	8	13242625	missense	probably damaging	1.00
R5209:Adprhl1	UTSW	8	13242563	nonsense	probably null
R6103:Adprhl1	UTSW	8	13222055	missense	possibly damaging	0.91
R6158:Adprhl1	UTSW	8	13224977	missense	possibly damaging	0.93
R6221:Adprhl1	UTSW	8	13225634	missense	probably benign	0.01
R6971:Adprhl1	UTSW	8	13223476	missense	probably benign
R7087:Adprhl1	UTSW	8	13221856	missense	probably damaging	0.99
R7362:Adprhl1	UTSW	8	13245534	missense	probably damaging	1.00
R7404:Adprhl1	UTSW	8	13225118	missense	probably damaging	0.99
R7422:Adprhl1	UTSW	8	13222873	missense	probably benign	0.28
R7439:Adprhl1	UTSW	8	13223069	missense	probably benign	0.01
R7441:Adprhl1	UTSW	8	13223069	missense	probably benign	0.01
R7772:Adprhl1	UTSW	8	13248682	missense	probably damaging	1.00
R7773:Adprhl1	UTSW	8	13248682	missense	probably damaging	1.00
R7774:Adprhl1	UTSW	8	13248682	missense	probably damaging	1.00
R7776:Adprhl1	UTSW	8	13248682	missense	probably damaging	1.00
R7876:Adprhl1	UTSW	8	13223509	missense	probably benign	0.00
R7877:Adprhl1	UTSW	8	13225316	nonsense	probably null
R7926:Adprhl1	UTSW	8	13248682	missense	probably damaging	1.00
R7927:Adprhl1	UTSW	8	13248682	missense	probably damaging	1.00
R7928:Adprhl1	UTSW	8	13248682	missense	probably damaging	1.00
R7929:Adprhl1	UTSW	8	13248682	missense	probably damaging	1.00
R7944:Adprhl1	UTSW	8	13221929	missense	probably damaging	0.99
R7945:Adprhl1	UTSW	8	13221929	missense	probably damaging	0.99
R7946:Adprhl1	UTSW	8	13248682	missense	probably damaging	1.00
R7947:Adprhl1	UTSW	8	13248682	missense	probably damaging	1.00
R7949:Adprhl1	UTSW	8	13224225	missense	possibly damaging	0.93
R8155:Adprhl1	UTSW	8	13221764	missense	probably damaging	0.99
R8182:Adprhl1	UTSW	8	13222774	missense	probably benign	0.07
Z1176:Adprhl1	UTSW	8	13225613	missense	probably benign	0.01
Z1177:Adprhl1	UTSW	8	13245476	missense	possibly damaging	0.68

Predicted Primers

PCR Primer
(F):5'- GCTCAAGCAAGCTGGGATAG -3'
(R):5'- TTATCCAGGTGGCAGAGGAGTC -3'

Sequencing Primer
(F):5'- ATGCCCTGCCTGTCAAAG -3'
(R):5'- TGGCAGAGGAGTCACCATTG -3'

Posted On

2016-06-06