Incidental Mutation 'R5060:Adprhl1'
ID386563
Institutional Source Beutler Lab
Gene Symbol Adprhl1
Ensembl Gene ENSMUSG00000031448
Gene NameADP-ribosylhydrolase like 1
SynonymsArh2, D330008N11Rik
MMRRC Submission 042650-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5060 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location13221663-13254162 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 13248621 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 103 (I103T)
Ref Sequence ENSEMBL: ENSMUSP00000145145 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033825] [ENSMUST00000168498] [ENSMUST00000171619] [ENSMUST00000204916]
Predicted Effect probably benign
Transcript: ENSMUST00000033825
AA Change: I103T

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000033825
Gene: ENSMUSG00000031448
AA Change: I103T

DomainStartEndE-ValueType
Pfam:ADP_ribosyl_GH 6 327 1.2e-53 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000168498
SMART Domains Protein: ENSMUSP00000131920
Gene: ENSMUSG00000031448

DomainStartEndE-ValueType
Pfam:ADP_ribosyl_GH 69 196 9e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171619
AA Change: I22T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000132014
Gene: ENSMUSG00000031448
AA Change: I22T

DomainStartEndE-ValueType
Pfam:ADP_ribosyl_GH 1 135 4.9e-18 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000204916
AA Change: I103T

PolyPhen 2 Score 0.626 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000145145
Gene: ENSMUSG00000031448
AA Change: I103T

DomainStartEndE-ValueType
Pfam:ADP_ribosyl_GH 6 327 4.2e-49 PFAM
low complexity region 509 527 N/A INTRINSIC
low complexity region 955 969 N/A INTRINSIC
internal_repeat_1 1047 1150 1.82e-5 PROSPERO
internal_repeat_1 1157 1274 1.82e-5 PROSPERO
low complexity region 1275 1290 N/A INTRINSIC
Meta Mutation Damage Score 0.1031 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 92.9%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] ADP-ribosylation is a reversible posttranslational modification used to regulate protein function. ADP-ribosyltransferases (see ART1; MIM 601625) transfer ADP-ribose from NAD+ to the target protein, and ADP-ribosylhydrolases, such as ADPRHL1, reverse the reaction (Glowacki et al., 2002 [PubMed 12070318]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A530064D06Rik A T 17: 48,166,939 L17Q probably damaging Het
Abca6 A G 11: 110,219,604 V573A possibly damaging Het
Abcc9 A G 6: 142,626,110 probably benign Het
Actg1 A G 11: 120,347,013 S234P probably benign Het
Acvr2a A G 2: 48,890,299 D177G probably damaging Het
Adamts12 T C 15: 11,299,968 C914R probably damaging Het
Als2cl C T 9: 110,884,137 L32F probably damaging Het
Ank2 T C 3: 126,945,921 probably benign Het
Ankrd52 T A 10: 128,389,841 S959R possibly damaging Het
Bnc2 C A 4: 84,531,635 A122S probably benign Het
Cfap54 C T 10: 93,039,151 V443M probably damaging Het
Clca4b T A 3: 144,911,506 R794S probably damaging Het
Col4a3bp A T 13: 96,603,155 K226N probably benign Het
Cyp2c65 T C 19: 39,061,070 L14P unknown Het
Ggt5 T C 10: 75,604,774 M243T probably benign Het
Gmds A G 13: 31,940,499 I292T probably benign Het
Gpcpd1 A T 2: 132,544,435 V341E probably damaging Het
Grm3 A G 5: 9,570,167 F359S probably damaging Het
Hcn1 A T 13: 117,873,905 K340* probably null Het
Heatr9 T C 11: 83,512,432 E427G probably benign Het
Ick C T 9: 78,153,696 T208I probably benign Het
Kif26b G A 1: 178,530,630 G102D unknown Het
Mark3 T C 12: 111,618,326 F119L probably damaging Het
Melk T C 4: 44,350,959 V500A probably benign Het
Mrpl41 A G 2: 24,974,283 F126L probably damaging Het
Olfr803 C T 10: 129,691,830 M70I probably benign Het
Olfr95 C A 17: 37,211,416 A146S probably benign Het
Pax7 A T 4: 139,779,617 S372T probably benign Het
Pax7 A T 4: 139,829,595 I118N probably damaging Het
Plcl1 G T 1: 55,696,512 M337I possibly damaging Het
Poc1a G T 9: 106,349,813 probably benign Het
Rabgef1 A G 5: 130,212,003 Y321C probably damaging Het
Rhobtb3 A C 13: 75,913,270 L252R probably benign Het
Rlf A G 4: 121,146,866 V1639A probably benign Het
Tff1 A G 17: 31,162,708 V65A probably damaging Het
Trpm4 G T 7: 45,321,834 D222E probably damaging Het
Ttn A T 2: 76,813,397 D13162E probably damaging Het
Unc5d A T 8: 28,719,695 S466T probably benign Het
Vmn1r73 A G 7: 11,756,756 Y167C probably damaging Het
Vwde C T 6: 13,208,324 probably null Het
Xpr1 T C 1: 155,328,684 probably null Het
Zbtb40 A G 4: 137,001,293 V413A possibly damaging Het
Other mutations in Adprhl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03268:Adprhl1 APN 8 13246170 splice site probably benign
R0244:Adprhl1 UTSW 8 13242391 splice site probably benign
R0636:Adprhl1 UTSW 8 13248702 missense probably damaging 1.00
R1295:Adprhl1 UTSW 8 13248624 missense probably damaging 1.00
R2111:Adprhl1 UTSW 8 13248694 missense probably damaging 1.00
R2112:Adprhl1 UTSW 8 13248694 missense probably damaging 1.00
R2184:Adprhl1 UTSW 8 13242559 missense probably benign 0.00
R4411:Adprhl1 UTSW 8 13246114 missense probably benign 0.16
R4412:Adprhl1 UTSW 8 13246114 missense probably benign 0.16
R4413:Adprhl1 UTSW 8 13246114 missense probably benign 0.16
R4615:Adprhl1 UTSW 8 13242250 critical splice donor site probably null
R4618:Adprhl1 UTSW 8 13242250 critical splice donor site probably null
R5016:Adprhl1 UTSW 8 13224889 missense possibly damaging 0.88
R5058:Adprhl1 UTSW 8 13242625 missense probably damaging 1.00
R5209:Adprhl1 UTSW 8 13242563 nonsense probably null
R6103:Adprhl1 UTSW 8 13222055 missense possibly damaging 0.91
R6158:Adprhl1 UTSW 8 13224977 missense possibly damaging 0.93
R6221:Adprhl1 UTSW 8 13225634 missense probably benign 0.01
R6971:Adprhl1 UTSW 8 13223476 missense probably benign
R7087:Adprhl1 UTSW 8 13221856 missense probably damaging 0.99
R7362:Adprhl1 UTSW 8 13245534 missense probably damaging 1.00
R7404:Adprhl1 UTSW 8 13225118 missense probably damaging 0.99
R7422:Adprhl1 UTSW 8 13222873 missense probably benign 0.28
R7439:Adprhl1 UTSW 8 13223069 missense probably benign 0.01
R7441:Adprhl1 UTSW 8 13223069 missense probably benign 0.01
R7772:Adprhl1 UTSW 8 13248682 missense probably damaging 1.00
R7773:Adprhl1 UTSW 8 13248682 missense probably damaging 1.00
R7774:Adprhl1 UTSW 8 13248682 missense probably damaging 1.00
R7776:Adprhl1 UTSW 8 13248682 missense probably damaging 1.00
R7876:Adprhl1 UTSW 8 13223509 missense probably benign 0.00
R7877:Adprhl1 UTSW 8 13225316 nonsense probably null
R7959:Adprhl1 UTSW 8 13223509 missense probably benign 0.00
R7960:Adprhl1 UTSW 8 13225316 nonsense probably null
Z1176:Adprhl1 UTSW 8 13225613 missense probably benign 0.01
Z1177:Adprhl1 UTSW 8 13245476 missense possibly damaging 0.68
Predicted Primers PCR Primer
(F):5'- GCTCAAGCAAGCTGGGATAG -3'
(R):5'- TTATCCAGGTGGCAGAGGAGTC -3'

Sequencing Primer
(F):5'- ATGCCCTGCCTGTCAAAG -3'
(R):5'- TGGCAGAGGAGTCACCATTG -3'
Posted On2016-06-06