Incidental Mutation 'R5060:Ggt5'
ID386568
Institutional Source Beutler Lab
Gene Symbol Ggt5
Ensembl Gene ENSMUSG00000006344
Gene Namegamma-glutamyltransferase 5
SynonymsGGL, Ggtla1, GGT-REL, gamma-glutamyl leukotrienase
MMRRC Submission 042650-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5060 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location75589340-75617200 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 75604774 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 243 (M243T)
Ref Sequence ENSEMBL: ENSMUSP00000072074 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072217] [ENSMUST00000189972] [ENSMUST00000218807]
Predicted Effect probably benign
Transcript: ENSMUST00000072217
AA Change: M243T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000072074
Gene: ENSMUSG00000006344
AA Change: M243T

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:G_glu_transpept 58 568 1.6e-164 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188444
Predicted Effect probably benign
Transcript: ENSMUST00000189972
SMART Domains Protein: ENSMUSP00000139459
Gene: ENSMUSG00000006344

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000189991
Predicted Effect probably benign
Transcript: ENSMUST00000218807
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219214
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219247
Meta Mutation Damage Score 0.0742 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 92.9%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the gamma-glutamyl transpeptidase gene family, and some reports indicate that it is capable of cleaving the gamma-glutamyl moiety of glutathione. The protein encoded by this gene is synthesized as a single, catalytically-inactive polypeptide, that is processed post-transcriptionally to form a heavy and light subunit, with the catalytic activity contained within the small subunit. The encoded enzyme is able to convert leukotriene C4 to leukotriene D4, but appears to have distinct substrate specificity compared to gamma-glutamyl transpeptidase. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Oct 2014]
PHENOTYPE: Homozygous mutants show an attenuation in neutrophil recruitment in an experimental model of peritonitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A530064D06Rik A T 17: 48,166,939 L17Q probably damaging Het
Abca6 A G 11: 110,219,604 V573A possibly damaging Het
Abcc9 A G 6: 142,626,110 probably benign Het
Actg1 A G 11: 120,347,013 S234P probably benign Het
Acvr2a A G 2: 48,890,299 D177G probably damaging Het
Adamts12 T C 15: 11,299,968 C914R probably damaging Het
Adprhl1 A G 8: 13,248,621 I103T possibly damaging Het
Als2cl C T 9: 110,884,137 L32F probably damaging Het
Ank2 T C 3: 126,945,921 probably benign Het
Ankrd52 T A 10: 128,389,841 S959R possibly damaging Het
Bnc2 C A 4: 84,531,635 A122S probably benign Het
Cfap54 C T 10: 93,039,151 V443M probably damaging Het
Clca4b T A 3: 144,911,506 R794S probably damaging Het
Col4a3bp A T 13: 96,603,155 K226N probably benign Het
Cyp2c65 T C 19: 39,061,070 L14P unknown Het
Gmds A G 13: 31,940,499 I292T probably benign Het
Gpcpd1 A T 2: 132,544,435 V341E probably damaging Het
Grm3 A G 5: 9,570,167 F359S probably damaging Het
Hcn1 A T 13: 117,873,905 K340* probably null Het
Heatr9 T C 11: 83,512,432 E427G probably benign Het
Ick C T 9: 78,153,696 T208I probably benign Het
Kif26b G A 1: 178,530,630 G102D unknown Het
Mark3 T C 12: 111,618,326 F119L probably damaging Het
Melk T C 4: 44,350,959 V500A probably benign Het
Mrpl41 A G 2: 24,974,283 F126L probably damaging Het
Olfr803 C T 10: 129,691,830 M70I probably benign Het
Olfr95 C A 17: 37,211,416 A146S probably benign Het
Pax7 A T 4: 139,779,617 S372T probably benign Het
Pax7 A T 4: 139,829,595 I118N probably damaging Het
Plcl1 G T 1: 55,696,512 M337I possibly damaging Het
Poc1a G T 9: 106,349,813 probably benign Het
Rabgef1 A G 5: 130,212,003 Y321C probably damaging Het
Rhobtb3 A C 13: 75,913,270 L252R probably benign Het
Rlf A G 4: 121,146,866 V1639A probably benign Het
Tff1 A G 17: 31,162,708 V65A probably damaging Het
Trpm4 G T 7: 45,321,834 D222E probably damaging Het
Ttn A T 2: 76,813,397 D13162E probably damaging Het
Unc5d A T 8: 28,719,695 S466T probably benign Het
Vmn1r73 A G 7: 11,756,756 Y167C probably damaging Het
Vwde C T 6: 13,208,324 probably null Het
Xpr1 T C 1: 155,328,684 probably null Het
Zbtb40 A G 4: 137,001,293 V413A possibly damaging Het
Other mutations in Ggt5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01503:Ggt5 APN 10 75610110 splice site probably benign
IGL01926:Ggt5 APN 10 75604101 missense probably benign 0.00
IGL02095:Ggt5 APN 10 75608803 missense probably benign 0.01
IGL02252:Ggt5 APN 10 75602732 missense possibly damaging 0.51
IGL02393:Ggt5 APN 10 75610237 splice site probably benign
IGL02515:Ggt5 APN 10 75589770 missense probably benign 0.23
IGL02528:Ggt5 APN 10 75610420 splice site probably benign
IGL02964:Ggt5 APN 10 75604128 missense probably benign 0.08
R0646:Ggt5 UTSW 10 75602648 missense probably damaging 0.99
R0834:Ggt5 UTSW 10 75604770 missense possibly damaging 0.73
R1454:Ggt5 UTSW 10 75609908 missense probably benign 0.01
R1650:Ggt5 UTSW 10 75604761 missense probably benign 0.00
R1846:Ggt5 UTSW 10 75610542 splice site probably null
R1896:Ggt5 UTSW 10 75604726 missense probably damaging 1.00
R2044:Ggt5 UTSW 10 75604087 missense probably damaging 0.97
R2357:Ggt5 UTSW 10 75609241 missense probably benign 0.19
R3151:Ggt5 UTSW 10 75609242 missense probably benign 0.35
R4667:Ggt5 UTSW 10 75603031 missense probably damaging 1.00
R4669:Ggt5 UTSW 10 75603031 missense probably damaging 1.00
R5756:Ggt5 UTSW 10 75604773 missense probably benign
R6156:Ggt5 UTSW 10 75609326 missense probably damaging 1.00
R6162:Ggt5 UTSW 10 75589792 missense possibly damaging 0.92
R6900:Ggt5 UTSW 10 75610537 missense possibly damaging 0.81
R8258:Ggt5 UTSW 10 75614832 missense probably benign 0.04
R8259:Ggt5 UTSW 10 75614832 missense probably benign 0.04
Z1088:Ggt5 UTSW 10 75608759 missense possibly damaging 0.81
Z1176:Ggt5 UTSW 10 75602618 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- TGACGATTTCTCTAGGGCTCTG -3'
(R):5'- TAGCAACGATCAGGCTGGAC -3'

Sequencing Primer
(F):5'- AGTGTCCTCTGAGATCTGGCATC -3'
(R):5'- ATCAGGCTGGACCACACG -3'
Posted On2016-06-06