Incidental Mutation 'R5060:Actg1'
ID386574
Institutional Source Beutler Lab
Gene Symbol Actg1
Ensembl Gene ENSMUSG00000062825
Gene Nameactin, gamma, cytoplasmic 1
SynonymsActl, E51
MMRRC Submission 042650-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5060 (G1)
Quality Score112
Status Validated
Chromosome11
Chromosomal Location120345690-120348542 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 120347013 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 234 (S234P)
Ref Sequence ENSEMBL: ENSMUSP00000101822 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062147] [ENSMUST00000071555] [ENSMUST00000089616] [ENSMUST00000106215] [ENSMUST00000128055] [ENSMUST00000131103]
Predicted Effect probably benign
Transcript: ENSMUST00000062147
SMART Domains Protein: ENSMUSP00000101821
Gene: ENSMUSG00000062825

DomainStartEndE-ValueType
ACTIN 5 153 1.43e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000071555
AA Change: S234P

PolyPhen 2 Score 0.104 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000071486
Gene: ENSMUSG00000062825
AA Change: S234P

DomainStartEndE-ValueType
ACTIN 5 375 2.96e-244 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000089616
SMART Domains Protein: ENSMUSP00000087043
Gene: ENSMUSG00000062825

DomainStartEndE-ValueType
Pfam:Actin 1 84 3.8e-32 PFAM
Pfam:Actin 78 105 1.1e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106215
AA Change: S234P

PolyPhen 2 Score 0.104 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000101822
Gene: ENSMUSG00000062825
AA Change: S234P

DomainStartEndE-ValueType
ACTIN 5 375 2.96e-244 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000128055
SMART Domains Protein: ENSMUSP00000134296
Gene: ENSMUSG00000062825

DomainStartEndE-ValueType
ACTIN 62 268 6.73e-61 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000131103
SMART Domains Protein: ENSMUSP00000134070
Gene: ENSMUSG00000062825

DomainStartEndE-ValueType
Pfam:Actin 2 124 1.1e-48 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141406
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143813
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144868
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156343
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175523
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183615
Meta Mutation Damage Score 0.2240 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 92.9%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: Actins are highly conserved proteins that are involved in various types of cell motility and maintenance of the cytoskeleton. In vertebrates, three main groups of actin isoforms, alpha, beta, and gamma, have been identified. The alpha actins are found in muscle tissues and are a major constituent of the contractile apparatus. The beta and gamma actins co-exist in most cell types as components of the cytoskeleton, and as mediators of internal cell motility. Actin, gamma 1, encoded by this gene, is a cytoplasmic actin found in non-muscle cells. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice in which this gene has been conditionally disrupted in muscle tissue display a reduced mobility and classical hind limb contractures when suspended by the tail. Mice homozygous for a null allele exhibit prenatal lethality, premature death, and progressive hearing loss. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A530064D06Rik A T 17: 48,166,939 L17Q probably damaging Het
Abca6 A G 11: 110,219,604 V573A possibly damaging Het
Abcc9 A G 6: 142,626,110 probably benign Het
Acvr2a A G 2: 48,890,299 D177G probably damaging Het
Adamts12 T C 15: 11,299,968 C914R probably damaging Het
Adprhl1 A G 8: 13,248,621 I103T possibly damaging Het
Als2cl C T 9: 110,884,137 L32F probably damaging Het
Ank2 T C 3: 126,945,921 probably benign Het
Ankrd52 T A 10: 128,389,841 S959R possibly damaging Het
Bnc2 C A 4: 84,531,635 A122S probably benign Het
Cfap54 C T 10: 93,039,151 V443M probably damaging Het
Clca4b T A 3: 144,911,506 R794S probably damaging Het
Col4a3bp A T 13: 96,603,155 K226N probably benign Het
Cyp2c65 T C 19: 39,061,070 L14P unknown Het
Ggt5 T C 10: 75,604,774 M243T probably benign Het
Gmds A G 13: 31,940,499 I292T probably benign Het
Gpcpd1 A T 2: 132,544,435 V341E probably damaging Het
Grm3 A G 5: 9,570,167 F359S probably damaging Het
Hcn1 A T 13: 117,873,905 K340* probably null Het
Heatr9 T C 11: 83,512,432 E427G probably benign Het
Ick C T 9: 78,153,696 T208I probably benign Het
Kif26b G A 1: 178,530,630 G102D unknown Het
Mark3 T C 12: 111,618,326 F119L probably damaging Het
Melk T C 4: 44,350,959 V500A probably benign Het
Mrpl41 A G 2: 24,974,283 F126L probably damaging Het
Olfr803 C T 10: 129,691,830 M70I probably benign Het
Olfr95 C A 17: 37,211,416 A146S probably benign Het
Pax7 A T 4: 139,779,617 S372T probably benign Het
Pax7 A T 4: 139,829,595 I118N probably damaging Het
Plcl1 G T 1: 55,696,512 M337I possibly damaging Het
Poc1a G T 9: 106,349,813 probably benign Het
Rabgef1 A G 5: 130,212,003 Y321C probably damaging Het
Rhobtb3 A C 13: 75,913,270 L252R probably benign Het
Rlf A G 4: 121,146,866 V1639A probably benign Het
Tff1 A G 17: 31,162,708 V65A probably damaging Het
Trpm4 G T 7: 45,321,834 D222E probably damaging Het
Ttn A T 2: 76,813,397 D13162E probably damaging Het
Unc5d A T 8: 28,719,695 S466T probably benign Het
Vmn1r73 A G 7: 11,756,756 Y167C probably damaging Het
Vwde C T 6: 13,208,324 probably null Het
Xpr1 T C 1: 155,328,684 probably null Het
Zbtb40 A G 4: 137,001,293 V413A possibly damaging Het
Other mutations in Actg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0731:Actg1 UTSW 11 120346949 missense probably damaging 1.00
R2015:Actg1 UTSW 11 120346810 missense possibly damaging 0.95
R2860:Actg1 UTSW 11 120346801 missense probably benign 0.03
R2861:Actg1 UTSW 11 120346801 missense probably benign 0.03
R2862:Actg1 UTSW 11 120346801 missense probably benign 0.03
R4473:Actg1 UTSW 11 120348259 missense probably benign 0.01
R4732:Actg1 UTSW 11 120347479 splice site probably benign
R5004:Actg1 UTSW 11 120348160 intron probably benign
R5026:Actg1 UTSW 11 120346958 missense probably damaging 1.00
R5216:Actg1 UTSW 11 120347754 missense probably damaging 0.98
R6328:Actg1 UTSW 11 120347760 missense possibly damaging 0.90
R6660:Actg1 UTSW 11 120346755 missense probably damaging 1.00
R6888:Actg1 UTSW 11 120347315 missense probably damaging 1.00
Z1177:Actg1 UTSW 11 120348109 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ATGCCTAGGGAACAGAGCTC -3'
(R):5'- TGCCCATCTATGAGGGCTAC -3'

Sequencing Primer
(F):5'- TGCCTAGGGAACAGAGCTCATTTAG -3'
(R):5'- GGCTACGCCCTTCCCCAC -3'
Posted On2016-06-06