Incidental Mutation 'R5060:Mark3'
ID386575
Institutional Source Beutler Lab
Gene Symbol Mark3
Ensembl Gene ENSMUSG00000007411
Gene NameMAP/microtubule affinity regulating kinase 3
SynonymsA430080F22Rik, ETK-1, C-TAK1, 1600015G02Rik
MMRRC Submission 042650-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.203) question?
Stock #R5060 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location111574523-111656221 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 111618326 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 119 (F119L)
Ref Sequence ENSEMBL: ENSMUSP00000152727 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075281] [ENSMUST00000084953] [ENSMUST00000221448] [ENSMUST00000221459] [ENSMUST00000221753] [ENSMUST00000222870]
Predicted Effect probably damaging
Transcript: ENSMUST00000075281
AA Change: F119L

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000074757
Gene: ENSMUSG00000007411
AA Change: F119L

DomainStartEndE-ValueType
S_TKc 56 307 7.4e-109 SMART
UBA 328 365 6.91e-9 SMART
low complexity region 368 385 N/A INTRINSIC
low complexity region 406 419 N/A INTRINSIC
Pfam:KA1 683 729 3.7e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000084953
AA Change: F119L

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000082017
Gene: ENSMUSG00000007411
AA Change: F119L

DomainStartEndE-ValueType
S_TKc 56 307 7.4e-109 SMART
UBA 328 365 6.91e-9 SMART
low complexity region 368 385 N/A INTRINSIC
low complexity region 406 419 N/A INTRINSIC
Pfam:KA1 700 744 4e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220971
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221009
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221390
Predicted Effect probably benign
Transcript: ENSMUST00000221448
Predicted Effect probably damaging
Transcript: ENSMUST00000221459
AA Change: F119L

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221631
Predicted Effect probably damaging
Transcript: ENSMUST00000221753
AA Change: F119L

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222080
Predicted Effect unknown
Transcript: ENSMUST00000222870
AA Change: V51A
Meta Mutation Damage Score 0.8799 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 92.9%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is activated by phosphorylation and in turn is involved in the phosphorylation of tau proteins MAP2 and MAP4. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygous disruption of this gene results in decreased body weight, increased energy expenditure, reduced adiposity, and protection from high-fat diet induced obesity. On a high-fat diet, mice show resistance to hepatic steatosis, improved glucose tolerance, and decreased insulin levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A530064D06Rik A T 17: 48,166,939 L17Q probably damaging Het
Abca6 A G 11: 110,219,604 V573A possibly damaging Het
Abcc9 A G 6: 142,626,110 probably benign Het
Actg1 A G 11: 120,347,013 S234P probably benign Het
Acvr2a A G 2: 48,890,299 D177G probably damaging Het
Adamts12 T C 15: 11,299,968 C914R probably damaging Het
Adprhl1 A G 8: 13,248,621 I103T possibly damaging Het
Als2cl C T 9: 110,884,137 L32F probably damaging Het
Ank2 T C 3: 126,945,921 probably benign Het
Ankrd52 T A 10: 128,389,841 S959R possibly damaging Het
Bnc2 C A 4: 84,531,635 A122S probably benign Het
Cfap54 C T 10: 93,039,151 V443M probably damaging Het
Clca4b T A 3: 144,911,506 R794S probably damaging Het
Col4a3bp A T 13: 96,603,155 K226N probably benign Het
Cyp2c65 T C 19: 39,061,070 L14P unknown Het
Ggt5 T C 10: 75,604,774 M243T probably benign Het
Gmds A G 13: 31,940,499 I292T probably benign Het
Gpcpd1 A T 2: 132,544,435 V341E probably damaging Het
Grm3 A G 5: 9,570,167 F359S probably damaging Het
Hcn1 A T 13: 117,873,905 K340* probably null Het
Heatr9 T C 11: 83,512,432 E427G probably benign Het
Ick C T 9: 78,153,696 T208I probably benign Het
Kif26b G A 1: 178,530,630 G102D unknown Het
Melk T C 4: 44,350,959 V500A probably benign Het
Mrpl41 A G 2: 24,974,283 F126L probably damaging Het
Olfr803 C T 10: 129,691,830 M70I probably benign Het
Olfr95 C A 17: 37,211,416 A146S probably benign Het
Pax7 A T 4: 139,779,617 S372T probably benign Het
Pax7 A T 4: 139,829,595 I118N probably damaging Het
Plcl1 G T 1: 55,696,512 M337I possibly damaging Het
Poc1a G T 9: 106,349,813 probably benign Het
Rabgef1 A G 5: 130,212,003 Y321C probably damaging Het
Rhobtb3 A C 13: 75,913,270 L252R probably benign Het
Rlf A G 4: 121,146,866 V1639A probably benign Het
Tff1 A G 17: 31,162,708 V65A probably damaging Het
Trpm4 G T 7: 45,321,834 D222E probably damaging Het
Ttn A T 2: 76,813,397 D13162E probably damaging Het
Unc5d A T 8: 28,719,695 S466T probably benign Het
Vmn1r73 A G 7: 11,756,756 Y167C probably damaging Het
Vwde C T 6: 13,208,324 probably null Het
Xpr1 T C 1: 155,328,684 probably null Het
Zbtb40 A G 4: 137,001,293 V413A possibly damaging Het
Other mutations in Mark3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01609:Mark3 APN 12 111627522 missense probably damaging 0.99
IGL02047:Mark3 APN 12 111618363 missense probably damaging 1.00
IGL02345:Mark3 APN 12 111627107 missense probably damaging 0.99
IGL02637:Mark3 APN 12 111592656 missense probably damaging 0.98
IGL03310:Mark3 APN 12 111647670 missense probably benign
IGL03349:Mark3 APN 12 111628250 missense probably benign 0.19
R0377:Mark3 UTSW 12 111629029 missense probably damaging 0.96
R0551:Mark3 UTSW 12 111633634 missense probably benign
R0846:Mark3 UTSW 12 111627224 missense possibly damaging 0.85
R1104:Mark3 UTSW 12 111618397 splice site probably benign
R1305:Mark3 UTSW 12 111615446 critical splice donor site probably null
R1344:Mark3 UTSW 12 111627837 missense possibly damaging 0.94
R1418:Mark3 UTSW 12 111627837 missense possibly damaging 0.94
R1434:Mark3 UTSW 12 111623325 splice site probably benign
R1556:Mark3 UTSW 12 111627841 missense probably damaging 0.98
R1569:Mark3 UTSW 12 111633746 missense probably benign 0.01
R1582:Mark3 UTSW 12 111655310 missense probably benign 0.12
R1936:Mark3 UTSW 12 111618365 missense probably damaging 0.99
R1975:Mark3 UTSW 12 111615441 missense probably damaging 1.00
R2507:Mark3 UTSW 12 111627242 missense probably damaging 1.00
R4394:Mark3 UTSW 12 111604523 missense possibly damaging 0.91
R4912:Mark3 UTSW 12 111592653 missense probably benign 0.42
R4926:Mark3 UTSW 12 111618324 nonsense probably null
R5133:Mark3 UTSW 12 111655328 missense probably damaging 1.00
R5813:Mark3 UTSW 12 111655443 missense probably damaging 1.00
R5834:Mark3 UTSW 12 111624487 missense probably damaging 0.99
R5926:Mark3 UTSW 12 111592734 missense probably damaging 1.00
R6523:Mark3 UTSW 12 111627235 missense probably damaging 1.00
R6663:Mark3 UTSW 12 111575083 missense probably benign 0.42
R6719:Mark3 UTSW 12 111615442 missense probably damaging 1.00
R6942:Mark3 UTSW 12 111592654 missense probably null 0.02
R6966:Mark3 UTSW 12 111640024 missense probably damaging 0.96
R6978:Mark3 UTSW 12 111627148 missense probably benign
R7303:Mark3 UTSW 12 111655536 missense probably damaging 1.00
R7408:Mark3 UTSW 12 111633789 missense probably damaging 0.99
R7454:Mark3 UTSW 12 111604527 missense probably damaging 1.00
R7680:Mark3 UTSW 12 111646773 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGAGAAGCTTGATGTTTATGGCTTC -3'
(R):5'- TCGGACCCCAGTTTACTGTG -3'

Sequencing Primer
(F):5'- TCTTGGTTTTCTTTTACGAAATTCTG -3'
(R):5'- ACCCCAGTTTACTGTGTTGAG -3'
Posted On2016-06-06