Incidental Mutation 'R5060:Rhobtb3'
ID386577
Institutional Source Beutler Lab
Gene Symbol Rhobtb3
Ensembl Gene ENSMUSG00000021589
Gene NameRho-related BTB domain containing 3
Synonyms2610033K01Rik, 4930503C18Rik, 1700040C17Rik
MMRRC Submission 042650-MU
Accession Numbers

Ncbi RefSeq: NM_028493.2; MGI:1920546

Is this an essential gene? Probably non essential (E-score: 0.212) question?
Stock #R5060 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location75869537-75943925 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 75913270 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Arginine at position 252 (L252R)
Ref Sequence ENSEMBL: ENSMUSP00000105235 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022078] [ENSMUST00000109606]
Predicted Effect probably benign
Transcript: ENSMUST00000022078
SMART Domains Protein: ENSMUSP00000022078
Gene: ENSMUSG00000021589

DomainStartEndE-ValueType
Pfam:Ras 47 195 9e-7 PFAM
Blast:BTB 254 406 2e-95 BLAST
BTB 420 518 3.12e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109606
AA Change: L252R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000105235
Gene: ENSMUSG00000021589
AA Change: L252R

DomainStartEndE-ValueType
Pfam:Ras 45 195 1.3e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000220939
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 92.9%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] RHOBTB3 is a member of the evolutionarily conserved RHOBTB subfamily of Rho GTPases. For background information on RHOBTBs, see RHOBTB1 (MIM 607351).[supplied by OMIM, Apr 2004]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit preweaning lethality, reduced body weight and slightly reduced organ weights that varies by sex. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted(2) Gene trapped(1)

Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A530064D06Rik A T 17: 48,166,939 L17Q probably damaging Het
Abca6 A G 11: 110,219,604 V573A possibly damaging Het
Abcc9 A G 6: 142,626,110 probably benign Het
Actg1 A G 11: 120,347,013 S234P probably benign Het
Acvr2a A G 2: 48,890,299 D177G probably damaging Het
Adamts12 T C 15: 11,299,968 C914R probably damaging Het
Adprhl1 A G 8: 13,248,621 I103T possibly damaging Het
Als2cl C T 9: 110,884,137 L32F probably damaging Het
Ank2 T C 3: 126,945,921 probably benign Het
Ankrd52 T A 10: 128,389,841 S959R possibly damaging Het
Bnc2 C A 4: 84,531,635 A122S probably benign Het
Cfap54 C T 10: 93,039,151 V443M probably damaging Het
Clca4b T A 3: 144,911,506 R794S probably damaging Het
Col4a3bp A T 13: 96,603,155 K226N probably benign Het
Cyp2c65 T C 19: 39,061,070 L14P unknown Het
Ggt5 T C 10: 75,604,774 M243T probably benign Het
Gmds A G 13: 31,940,499 I292T probably benign Het
Gpcpd1 A T 2: 132,544,435 V341E probably damaging Het
Grm3 A G 5: 9,570,167 F359S probably damaging Het
Hcn1 A T 13: 117,873,905 K340* probably null Het
Heatr9 T C 11: 83,512,432 E427G probably benign Het
Ick C T 9: 78,153,696 T208I probably benign Het
Kif26b G A 1: 178,530,630 G102D unknown Het
Mark3 T C 12: 111,618,326 F119L probably damaging Het
Melk T C 4: 44,350,959 V500A probably benign Het
Mrpl41 A G 2: 24,974,283 F126L probably damaging Het
Olfr803 C T 10: 129,691,830 M70I probably benign Het
Olfr95 C A 17: 37,211,416 A146S probably benign Het
Pax7 A T 4: 139,779,617 S372T probably benign Het
Pax7 A T 4: 139,829,595 I118N probably damaging Het
Plcl1 G T 1: 55,696,512 M337I possibly damaging Het
Poc1a G T 9: 106,349,813 probably benign Het
Rabgef1 A G 5: 130,212,003 Y321C probably damaging Het
Rlf A G 4: 121,146,866 V1639A probably benign Het
Tff1 A G 17: 31,162,708 V65A probably damaging Het
Trpm4 G T 7: 45,321,834 D222E probably damaging Het
Ttn A T 2: 76,813,397 D13162E probably damaging Het
Unc5d A T 8: 28,719,695 S466T probably benign Het
Vmn1r73 A G 7: 11,756,756 Y167C probably damaging Het
Vwde C T 6: 13,208,324 probably null Het
Xpr1 T C 1: 155,328,684 probably null Het
Zbtb40 A G 4: 137,001,293 V413A possibly damaging Het
Other mutations in Rhobtb3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02117:Rhobtb3 APN 13 75877428 missense probably damaging 1.00
IGL02142:Rhobtb3 APN 13 75877495 missense probably damaging 1.00
IGL02708:Rhobtb3 APN 13 75917724 missense probably damaging 0.99
IGL02732:Rhobtb3 APN 13 75910937 missense probably damaging 1.00
IGL02969:Rhobtb3 APN 13 75943431 missense probably damaging 1.00
R0048:Rhobtb3 UTSW 13 75902245 makesense probably null
R0285:Rhobtb3 UTSW 13 75877509 missense possibly damaging 0.86
R2233:Rhobtb3 UTSW 13 75872365 missense possibly damaging 0.76
R2289:Rhobtb3 UTSW 13 75910927 missense probably damaging 0.97
R2332:Rhobtb3 UTSW 13 75910852 missense probably benign 0.44
R3684:Rhobtb3 UTSW 13 75939481 missense probably damaging 1.00
R4685:Rhobtb3 UTSW 13 75878932 nonsense probably null
R5374:Rhobtb3 UTSW 13 75878895 missense probably damaging 0.98
R5688:Rhobtb3 UTSW 13 75872418 missense probably benign 0.01
R6181:Rhobtb3 UTSW 13 75910689 missense probably benign 0.05
R6235:Rhobtb3 UTSW 13 75892910 missense probably damaging 0.99
R6947:Rhobtb3 UTSW 13 75910666 missense probably benign 0.14
R7032:Rhobtb3 UTSW 13 75872394 missense probably benign 0.01
R7039:Rhobtb3 UTSW 13 75872453 nonsense probably null
R7148:Rhobtb3 UTSW 13 75910887 missense probably benign
R7449:Rhobtb3 UTSW 13 75910741 missense probably benign 0.14
R7508:Rhobtb3 UTSW 13 75878857 missense probably benign 0.00
R7598:Rhobtb3 UTSW 13 75910902 missense probably benign 0.00
R7691:Rhobtb3 UTSW 13 75878937 missense probably damaging 0.99
R7770:Rhobtb3 UTSW 13 75917815 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CTGCAGGTATTAGGCCATGG -3'
(R):5'- GCCATGCTGGACTTCTAATTCTG -3'

Sequencing Primer
(F):5'- TCACCAAGTGTCCCAAGGTTG -3'
(R):5'- GCTGGAGTATTTTATGATTCAAGCC -3'
Posted On2016-06-06