Incidental Mutation 'R5060:Hcn1'
ID386578
Institutional Source Beutler Lab
Gene Symbol Hcn1
Ensembl Gene ENSMUSG00000021730
Gene Namehyperpolarization-activated, cyclic nucleotide-gated K+ 1
SynonymsHAC2, Bcng1, C630013B14Rik
MMRRC Submission 042650-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5060 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location117602320-117987418 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 117873905 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 340 (K340*)
Ref Sequence ENSEMBL: ENSMUSP00000006991 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006991]
PDB Structure
Tetramerization dynamics of the C-terminus underlies isoform-specific cAMP-gating in HCN channels [X-RAY DIFFRACTION]
Predicted Effect probably null
Transcript: ENSMUST00000006991
AA Change: K340*
SMART Domains Protein: ENSMUSP00000006991
Gene: ENSMUSG00000021730
AA Change: K340*

DomainStartEndE-ValueType
Pfam:Ion_trans_N 87 130 8.2e-24 PFAM
Pfam:Ion_trans 131 394 2.1e-23 PFAM
low complexity region 395 406 N/A INTRINSIC
Blast:cNMP 407 439 4e-13 BLAST
cNMP 464 580 1.95e-22 SMART
low complexity region 639 655 N/A INTRINSIC
low complexity region 660 680 N/A INTRINSIC
low complexity region 720 779 N/A INTRINSIC
low complexity region 878 886 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 92.9%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The membrane protein encoded by this gene is a hyperpolarization-activated cation channel that contributes to the native pacemaker currents in heart and neurons. The encoded protein can homodimerize or heterodimerize with other pore-forming subunits to form a potassium channel. This channel may act as a receptor for sour tastes. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for disruptions in this allele display learning deficiencies but are otherwise normal. Mice homozygous for another targeted knock-out exhibit deficit in hyperpolarization-activated currents and cold allodynia following partial nerve ligation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A530064D06Rik A T 17: 48,166,939 L17Q probably damaging Het
Abca6 A G 11: 110,219,604 V573A possibly damaging Het
Abcc9 A G 6: 142,626,110 probably benign Het
Actg1 A G 11: 120,347,013 S234P probably benign Het
Acvr2a A G 2: 48,890,299 D177G probably damaging Het
Adamts12 T C 15: 11,299,968 C914R probably damaging Het
Adprhl1 A G 8: 13,248,621 I103T possibly damaging Het
Als2cl C T 9: 110,884,137 L32F probably damaging Het
Ank2 T C 3: 126,945,921 probably benign Het
Ankrd52 T A 10: 128,389,841 S959R possibly damaging Het
Bnc2 C A 4: 84,531,635 A122S probably benign Het
Cfap54 C T 10: 93,039,151 V443M probably damaging Het
Clca4b T A 3: 144,911,506 R794S probably damaging Het
Col4a3bp A T 13: 96,603,155 K226N probably benign Het
Cyp2c65 T C 19: 39,061,070 L14P unknown Het
Ggt5 T C 10: 75,604,774 M243T probably benign Het
Gmds A G 13: 31,940,499 I292T probably benign Het
Gpcpd1 A T 2: 132,544,435 V341E probably damaging Het
Grm3 A G 5: 9,570,167 F359S probably damaging Het
Heatr9 T C 11: 83,512,432 E427G probably benign Het
Ick C T 9: 78,153,696 T208I probably benign Het
Kif26b G A 1: 178,530,630 G102D unknown Het
Mark3 T C 12: 111,618,326 F119L probably damaging Het
Melk T C 4: 44,350,959 V500A probably benign Het
Mrpl41 A G 2: 24,974,283 F126L probably damaging Het
Olfr803 C T 10: 129,691,830 M70I probably benign Het
Olfr95 C A 17: 37,211,416 A146S probably benign Het
Pax7 A T 4: 139,779,617 S372T probably benign Het
Pax7 A T 4: 139,829,595 I118N probably damaging Het
Plcl1 G T 1: 55,696,512 M337I possibly damaging Het
Poc1a G T 9: 106,349,813 probably benign Het
Rabgef1 A G 5: 130,212,003 Y321C probably damaging Het
Rhobtb3 A C 13: 75,913,270 L252R probably benign Het
Rlf A G 4: 121,146,866 V1639A probably benign Het
Tff1 A G 17: 31,162,708 V65A probably damaging Het
Trpm4 G T 7: 45,321,834 D222E probably damaging Het
Ttn A T 2: 76,813,397 D13162E probably damaging Het
Unc5d A T 8: 28,719,695 S466T probably benign Het
Vmn1r73 A G 7: 11,756,756 Y167C probably damaging Het
Vwde C T 6: 13,208,324 probably null Het
Xpr1 T C 1: 155,328,684 probably null Het
Zbtb40 A G 4: 137,001,293 V413A possibly damaging Het
Other mutations in Hcn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00231:Hcn1 APN 13 117975993 missense probably damaging 1.00
IGL00340:Hcn1 APN 13 117602977 missense unknown
IGL01161:Hcn1 APN 13 117656922 missense unknown
IGL01723:Hcn1 APN 13 117976055 missense probably damaging 0.98
IGL02324:Hcn1 APN 13 117902886 missense unknown
IGL02491:Hcn1 APN 13 117810040 missense unknown
Thump UTSW 13 117873905 nonsense probably null
FR4976:Hcn1 UTSW 13 117975808 small insertion probably benign
PIT4504001:Hcn1 UTSW 13 117975875 missense possibly damaging 0.90
R0420:Hcn1 UTSW 13 117975375 missense unknown
R1546:Hcn1 UTSW 13 117975766 small insertion probably benign
R1558:Hcn1 UTSW 13 117975576 missense unknown
R1659:Hcn1 UTSW 13 117976074 missense probably damaging 0.99
R1667:Hcn1 UTSW 13 117603073 missense unknown
R1766:Hcn1 UTSW 13 117656734 missense probably benign 0.39
R1842:Hcn1 UTSW 13 117976008 missense probably damaging 0.99
R2051:Hcn1 UTSW 13 117976083 missense probably damaging 0.99
R3605:Hcn1 UTSW 13 117975252 missense unknown
R4259:Hcn1 UTSW 13 117975348 missense unknown
R4284:Hcn1 UTSW 13 117975733 small deletion probably benign
R4637:Hcn1 UTSW 13 117975713 missense unknown
R4679:Hcn1 UTSW 13 117657015 missense probably benign 0.39
R4777:Hcn1 UTSW 13 117975733 small deletion probably benign
R4839:Hcn1 UTSW 13 117925710 missense unknown
R4883:Hcn1 UTSW 13 117902895 critical splice donor site probably null
R5015:Hcn1 UTSW 13 117603020 missense unknown
R5748:Hcn1 UTSW 13 117976055 missense probably damaging 0.99
R5823:Hcn1 UTSW 13 117602852 missense unknown
R6900:Hcn1 UTSW 13 117656827 missense probably benign 0.39
R7045:Hcn1 UTSW 13 117975462 missense unknown
R7049:Hcn1 UTSW 13 117975462 missense unknown
R7163:Hcn1 UTSW 13 117925547 missense unknown
R7534:Hcn1 UTSW 13 117975425 missense unknown
R7722:Hcn1 UTSW 13 117902778 missense unknown
Predicted Primers PCR Primer
(F):5'- CTAGGCTCACATGAACAAAAGG -3'
(R):5'- ACTGCCTCCTTGAAGAGTCC -3'

Sequencing Primer
(F):5'- GCATTTGGTTAGCATCCAGTTAGAAG -3'
(R):5'- TGCCTCCTTGAAGAGTCCAAAGAC -3'
Posted On2016-06-06