Incidental Mutation 'R5060:Olfr95'
ID386582
Institutional Source Beutler Lab
Gene Symbol Olfr95
Ensembl Gene ENSMUSG00000049561
Gene Nameolfactory receptor 95
SynonymsMOR263-6, GA_x6K02T2PSCP-1651760-1650822
MMRRC Submission 042650-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock #R5060 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location37207950-37213118 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 37211416 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 146 (A146S)
Ref Sequence ENSEMBL: ENSMUSP00000150480 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060728] [ENSMUST00000216318]
Predicted Effect probably benign
Transcript: ENSMUST00000060728
AA Change: A146S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000058929
Gene: ENSMUSG00000049561
AA Change: A146S

DomainStartEndE-ValueType
Pfam:7tm_4 30 307 1.9e-57 PFAM
Pfam:7TM_GPCR_Srsx 34 259 1.7e-6 PFAM
Pfam:7tm_1 40 289 2.2e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000216318
AA Change: A146S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 92.9%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A530064D06Rik A T 17: 48,166,939 L17Q probably damaging Het
Abca6 A G 11: 110,219,604 V573A possibly damaging Het
Abcc9 A G 6: 142,626,110 probably benign Het
Actg1 A G 11: 120,347,013 S234P probably benign Het
Acvr2a A G 2: 48,890,299 D177G probably damaging Het
Adamts12 T C 15: 11,299,968 C914R probably damaging Het
Adprhl1 A G 8: 13,248,621 I103T possibly damaging Het
Als2cl C T 9: 110,884,137 L32F probably damaging Het
Ank2 T C 3: 126,945,921 probably benign Het
Ankrd52 T A 10: 128,389,841 S959R possibly damaging Het
Bnc2 C A 4: 84,531,635 A122S probably benign Het
Cfap54 C T 10: 93,039,151 V443M probably damaging Het
Clca4b T A 3: 144,911,506 R794S probably damaging Het
Col4a3bp A T 13: 96,603,155 K226N probably benign Het
Cyp2c65 T C 19: 39,061,070 L14P unknown Het
Ggt5 T C 10: 75,604,774 M243T probably benign Het
Gmds A G 13: 31,940,499 I292T probably benign Het
Gpcpd1 A T 2: 132,544,435 V341E probably damaging Het
Grm3 A G 5: 9,570,167 F359S probably damaging Het
Hcn1 A T 13: 117,873,905 K340* probably null Het
Heatr9 T C 11: 83,512,432 E427G probably benign Het
Ick C T 9: 78,153,696 T208I probably benign Het
Kif26b G A 1: 178,530,630 G102D unknown Het
Mark3 T C 12: 111,618,326 F119L probably damaging Het
Melk T C 4: 44,350,959 V500A probably benign Het
Mrpl41 A G 2: 24,974,283 F126L probably damaging Het
Olfr803 C T 10: 129,691,830 M70I probably benign Het
Pax7 A T 4: 139,779,617 S372T probably benign Het
Pax7 A T 4: 139,829,595 I118N probably damaging Het
Plcl1 G T 1: 55,696,512 M337I possibly damaging Het
Poc1a G T 9: 106,349,813 probably benign Het
Rabgef1 A G 5: 130,212,003 Y321C probably damaging Het
Rhobtb3 A C 13: 75,913,270 L252R probably benign Het
Rlf A G 4: 121,146,866 V1639A probably benign Het
Tff1 A G 17: 31,162,708 V65A probably damaging Het
Trpm4 G T 7: 45,321,834 D222E probably damaging Het
Ttn A T 2: 76,813,397 D13162E probably damaging Het
Unc5d A T 8: 28,719,695 S466T probably benign Het
Vmn1r73 A G 7: 11,756,756 Y167C probably damaging Het
Vwde C T 6: 13,208,324 probably null Het
Xpr1 T C 1: 155,328,684 probably null Het
Zbtb40 A G 4: 137,001,293 V413A possibly damaging Het
Other mutations in Olfr95
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02147:Olfr95 APN 17 37210986 missense probably damaging 1.00
IGL03306:Olfr95 APN 17 37211677 missense probably damaging 1.00
PIT4377001:Olfr95 UTSW 17 37211089 missense probably benign 0.00
R0668:Olfr95 UTSW 17 37211644 missense probably damaging 1.00
R0909:Olfr95 UTSW 17 37210918 missense probably benign 0.33
R1442:Olfr95 UTSW 17 37211704 missense probably benign 0.00
R1557:Olfr95 UTSW 17 37211353 missense probably damaging 1.00
R1758:Olfr95 UTSW 17 37211313 missense possibly damaging 0.88
R3195:Olfr95 UTSW 17 37211536 missense possibly damaging 0.87
R3749:Olfr95 UTSW 17 37211800 missense possibly damaging 0.55
R3778:Olfr95 UTSW 17 37211758 missense probably benign
R4458:Olfr95 UTSW 17 37211313 missense possibly damaging 0.88
R4591:Olfr95 UTSW 17 37211119 missense probably benign
R5058:Olfr95 UTSW 17 37211667 missense probably damaging 1.00
R5903:Olfr95 UTSW 17 37211021 nonsense probably null
R6294:Olfr95 UTSW 17 37211626 missense probably benign 0.19
R6689:Olfr95 UTSW 17 37211157 missense probably damaging 1.00
R7196:Olfr95 UTSW 17 37211193 missense probably damaging 1.00
R7677:Olfr95 UTSW 17 37211495 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCCAGGATAATCTGCAGCTC -3'
(R):5'- CTGGAGATCTGCTACACGTC -3'

Sequencing Primer
(F):5'- CAGGATAATCTGCAGCTCGTTGAG -3'
(R):5'- AGATCTGCTACACGTCGGTCAC -3'
Posted On2016-06-06