Incidental Mutation 'R5060:Cyp2c65'
ID386584
Institutional Source Beutler Lab
Gene Symbol Cyp2c65
Ensembl Gene ENSMUSG00000067231
Gene Namecytochrome P450, family 2, subfamily c, polypeptide 65
Synonyms
MMRRC Submission 042650-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.081) question?
Stock #R5060 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location39061015-39093944 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 39061070 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 14 (L14P)
Ref Sequence ENSEMBL: ENSMUSP00000084489 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087236]
Predicted Effect unknown
Transcript: ENSMUST00000087236
AA Change: L14P
SMART Domains Protein: ENSMUSP00000084489
Gene: ENSMUSG00000067231
AA Change: L14P

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:p450 30 487 2.1e-160 PFAM
Meta Mutation Damage Score 0.0869 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 92.9%
Validation Efficiency 98% (52/53)
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A530064D06Rik A T 17: 48,166,939 L17Q probably damaging Het
Abca6 A G 11: 110,219,604 V573A possibly damaging Het
Abcc9 A G 6: 142,626,110 probably benign Het
Actg1 A G 11: 120,347,013 S234P probably benign Het
Acvr2a A G 2: 48,890,299 D177G probably damaging Het
Adamts12 T C 15: 11,299,968 C914R probably damaging Het
Adprhl1 A G 8: 13,248,621 I103T possibly damaging Het
Als2cl C T 9: 110,884,137 L32F probably damaging Het
Ank2 T C 3: 126,945,921 probably benign Het
Ankrd52 T A 10: 128,389,841 S959R possibly damaging Het
Bnc2 C A 4: 84,531,635 A122S probably benign Het
Cfap54 C T 10: 93,039,151 V443M probably damaging Het
Clca4b T A 3: 144,911,506 R794S probably damaging Het
Col4a3bp A T 13: 96,603,155 K226N probably benign Het
Ggt5 T C 10: 75,604,774 M243T probably benign Het
Gmds A G 13: 31,940,499 I292T probably benign Het
Gpcpd1 A T 2: 132,544,435 V341E probably damaging Het
Grm3 A G 5: 9,570,167 F359S probably damaging Het
Hcn1 A T 13: 117,873,905 K340* probably null Het
Heatr9 T C 11: 83,512,432 E427G probably benign Het
Ick C T 9: 78,153,696 T208I probably benign Het
Kif26b G A 1: 178,530,630 G102D unknown Het
Mark3 T C 12: 111,618,326 F119L probably damaging Het
Melk T C 4: 44,350,959 V500A probably benign Het
Mrpl41 A G 2: 24,974,283 F126L probably damaging Het
Olfr803 C T 10: 129,691,830 M70I probably benign Het
Olfr95 C A 17: 37,211,416 A146S probably benign Het
Pax7 A T 4: 139,779,617 S372T probably benign Het
Pax7 A T 4: 139,829,595 I118N probably damaging Het
Plcl1 G T 1: 55,696,512 M337I possibly damaging Het
Poc1a G T 9: 106,349,813 probably benign Het
Rabgef1 A G 5: 130,212,003 Y321C probably damaging Het
Rhobtb3 A C 13: 75,913,270 L252R probably benign Het
Rlf A G 4: 121,146,866 V1639A probably benign Het
Tff1 A G 17: 31,162,708 V65A probably damaging Het
Trpm4 G T 7: 45,321,834 D222E probably damaging Het
Ttn A T 2: 76,813,397 D13162E probably damaging Het
Unc5d A T 8: 28,719,695 S466T probably benign Het
Vmn1r73 A G 7: 11,756,756 Y167C probably damaging Het
Vwde C T 6: 13,208,324 probably null Het
Xpr1 T C 1: 155,328,684 probably null Het
Zbtb40 A G 4: 137,001,293 V413A possibly damaging Het
Other mutations in Cyp2c65
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01122:Cyp2c65 APN 19 39072177 critical splice acceptor site probably null
IGL01124:Cyp2c65 APN 19 39093510 utr 3 prime probably benign
IGL01895:Cyp2c65 APN 19 39072232 missense possibly damaging 0.90
IGL02544:Cyp2c65 APN 19 39090638 missense probably damaging 1.00
R0172:Cyp2c65 UTSW 19 39087656 missense possibly damaging 0.86
R0378:Cyp2c65 UTSW 19 39073218 missense probably benign 0.19
R0517:Cyp2c65 UTSW 19 39082348 splice site probably benign
R0585:Cyp2c65 UTSW 19 39069242 missense probably benign 0.00
R1770:Cyp2c65 UTSW 19 39082198 missense probably benign 0.07
R2051:Cyp2c65 UTSW 19 39082231 missense probably benign 0.12
R2310:Cyp2c65 UTSW 19 39093382 missense probably benign 0.02
R2911:Cyp2c65 UTSW 19 39087682 missense probably damaging 0.96
R4208:Cyp2c65 UTSW 19 39090655 missense probably damaging 1.00
R4258:Cyp2c65 UTSW 19 39093428 missense probably benign 0.41
R4734:Cyp2c65 UTSW 19 39072334 missense probably benign 0.00
R4821:Cyp2c65 UTSW 19 39072191 missense probably damaging 1.00
R4926:Cyp2c65 UTSW 19 39061153 missense probably benign 0.00
R5091:Cyp2c65 UTSW 19 39087565 critical splice acceptor site probably null
R5433:Cyp2c65 UTSW 19 39093484 missense probably benign 0.00
R6051:Cyp2c65 UTSW 19 39061166 missense probably benign 0.29
R6182:Cyp2c65 UTSW 19 39061162 missense probably benign 0.18
R6400:Cyp2c65 UTSW 19 39061114 missense possibly damaging 0.80
R6586:Cyp2c65 UTSW 19 39082218 missense possibly damaging 0.89
R6672:Cyp2c65 UTSW 19 39087674 missense probably damaging 1.00
R6850:Cyp2c65 UTSW 19 39069091 missense probably benign 0.15
Predicted Primers PCR Primer
(F):5'- GCCAGTACTTTAATCACGATGTTG -3'
(R):5'- ACATTGGCACTTCCCTTTGG -3'

Sequencing Primer
(F):5'- TGGAACAAAGTCCACTGGG -3'
(R):5'- CATTGGCACTTCCCTTTGGAGAAAG -3'
Posted On2016-06-06