Mutagenetix > Incidental Mutation

Incidental Mutation 'R0426:Arhgef12'

38659

Institutional Source

Beutler Lab

Gene Symbol

Arhgef12

Ensembl Gene

ENSMUSG00000059495

Gene Name

Rho guanine nucleotide exchange factor (GEF) 12

Synonyms

LARG, 2310014B11Rik

MMRRC Submission

038628-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.952) question?

Stock #

R0426 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

42963842-43107239 bp(-) (GRCm38)

Type of Mutation

splice site (3 bp from exon)

DNA Base Change (assembly)

T to C at 42970990 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000126598 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000072767] [ENSMUST00000165665]

AlphaFold

Q8R4H2

Predicted Effect

probably null
Transcript: ENSMUST00000072767

SMART Domains

Protein: ENSMUSP00000072547
Gene: ENSMUSG00000059495

Domain	Start	End	E-Value	Type
low complexity region	49	64	N/A	INTRINSIC
PDZ	80	148	1.64e-19	SMART
coiled coil region	196	259	N/A	INTRINSIC
low complexity region	293	313	N/A	INTRINSIC
Pfam:RGS-like	368	558	8.6e-87	PFAM
low complexity region	583	596	N/A	INTRINSIC
low complexity region	663	676	N/A	INTRINSIC
low complexity region	721	733	N/A	INTRINSIC
RhoGEF	791	976	6.35e-66	SMART
PH	1020	1134	6.26e-6	SMART
low complexity region	1256	1269	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000165665

SMART Domains

Protein: ENSMUSP00000126598
Gene: ENSMUSG00000059495

Domain	Start	End	E-Value	Type
low complexity region	49	64	N/A	INTRINSIC
PDZ	80	148	1.64e-19	SMART
coiled coil region	196	259	N/A	INTRINSIC
low complexity region	293	313	N/A	INTRINSIC
Pfam:RGS-like	369	559	1.6e-88	PFAM
low complexity region	584	597	N/A	INTRINSIC
low complexity region	664	677	N/A	INTRINSIC
low complexity region	722	734	N/A	INTRINSIC
RhoGEF	792	977	6.35e-66	SMART
PH	1021	1135	6.26e-6	SMART
low complexity region	1257	1270	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000216016

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.7%
20x: 93.9%

Validation Efficiency

96% (86/90)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Rho GTPases play a fundamental role in numerous cellular processes that are initiated by extracellular stimuli working through G protein-coupled receptors. The encoded protein may form a complex with G proteins and stimulate Rho-dependent signals. This protein has been observed to form a myeloid/lymphoid fusion partner in acute myeloid leukemia. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a null allele exhibit decreased sensitivity to certain vasoconstrictors and resistance to salt-induced hypertension. Mice homozygous for a different knock-out allele exhibit partial prenatal lethality. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 87 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A830010M20Rik	C	T	5: 107,510,373	T1603I	probably damaging	Het
Abca8b	G	T	11: 109,955,027		probably benign	Het
Acadl	A	T	1: 66,841,646	F320L	probably damaging	Het
Acsbg1	T	C	9: 54,622,746	D222G	probably benign	Het
Anapc15	A	G	7: 101,898,033	T39A	probably benign	Het
Ano3	A	T	2: 110,661,174	V919E	probably damaging	Het
Atad5	T	A	11: 80,112,832	I1091N	probably benign	Het
Atf1	A	T	15: 100,232,827	H26L	possibly damaging	Het
Atp10a	T	C	7: 58,784,734	M252T	probably benign	Het
Cd55	C	T	1: 130,448,372	R347H	probably benign	Het
Cdc27	A	C	11: 104,513,027		probably null	Het
Cdh9	G	A	15: 16,823,454		probably null	Het
Cdk11b	T	C	4: 155,642,512		probably benign	Het
Cep70	A	G	9: 99,297,684	D567G	probably benign	Het
Cep78	A	T	19: 15,970,970	Y382*	probably null	Het
Col9a2	T	C	4: 121,044,660		probably benign	Het
Cyp2d12	G	A	15: 82,558,963	D409N	probably benign	Het
Ddx39	A	G	8: 83,721,769	T217A	probably benign	Het
Dennd1b	T	A	1: 139,170,196	D733E	probably benign	Het
Dicer1	A	G	12: 104,702,542	S1294P	probably damaging	Het
Dnah3	T	C	7: 119,943,572	E3539G	probably benign	Het
Dnmbp	A	G	19: 43,852,436		probably benign	Het
Dysf	T	C	6: 84,149,757	L1332P	probably damaging	Het
F5	A	G	1: 164,182,840	D380G	probably damaging	Het
Fam160a2	A	C	7: 105,389,473	C186W	probably damaging	Het
Fam171a1	T	C	2: 3,225,396	V522A	probably benign	Het
Galr2	C	A	11: 116,281,691	A69D	probably damaging	Het
Grk2	T	C	19: 4,290,600		probably null	Het
Gtf3c1	A	T	7: 125,663,016	Y1119*	probably null	Het
Hgd	A	T	16: 37,588,685		probably benign	Het
Ildr2	G	T	1: 166,308,899	V436L	probably benign	Het
Intu	G	A	3: 40,675,305	C355Y	probably damaging	Het
Irf2bpl	G	T	12: 86,883,096	P268T	probably benign	Het
Jarid2	T	C	13: 44,840,882		probably null	Het
Jup	A	T	11: 100,372,401	M716K	probably benign	Het
Kank1	G	A	19: 25,411,473	V809I	probably damaging	Het
Kdm1b	T	A	13: 47,064,244		probably benign	Het
Kdm3a	C	T	6: 71,600,755	C687Y	probably damaging	Het
Kdm5d	T	A	Y: 942,437		probably benign	Het
Kifap3	T	A	1: 163,865,552		probably benign	Het
Macf1	T	A	4: 123,483,660	K1400*	probably null	Het
Majin	A	G	19: 6,212,117		probably benign	Het
Mb21d1	G	A	9: 78,435,738		probably benign	Het
Mctp1	A	G	13: 77,020,821	I846V	probably benign	Het
Mrgpra2b	T	A	7: 47,464,127	I286F	possibly damaging	Het
Neil3	T	G	8: 53,609,396		probably benign	Het
Nox3	G	T	17: 3,695,563	N23K	probably damaging	Het
Nt5c3	T	C	6: 56,883,812	K219E	probably benign	Het
Olfr1458	G	A	19: 13,103,278	R3C	possibly damaging	Het
Olfr213	A	T	6: 116,540,485	N11Y	probably damaging	Het
Olfr389	T	A	11: 73,776,437	M297L	probably benign	Het
Olfr524	A	C	7: 140,202,116	F218C	possibly damaging	Het
Olfr548-ps1	T	A	7: 102,542,686	I250N	probably damaging	Het
Olfr954	T	C	9: 39,461,593	L54P	probably damaging	Het
Pacsin2	A	G	15: 83,379,795	V347A	possibly damaging	Het
Pcdhb7	A	T	18: 37,342,804	E331V	probably damaging	Het
Pcid2	A	C	8: 13,081,262		probably null	Het
Pcsk9	T	C	4: 106,450,077	D323G	possibly damaging	Het
Pdhb	T	C	14: 8,169,801	E203G	probably damaging	Het
Phlpp2	A	G	8: 109,928,463	Y630C	probably benign	Het
Pidd1	C	T	7: 141,439,133	A812T	probably damaging	Het
Plau	G	A	14: 20,842,314	R389H	probably benign	Het
Plekhg6	G	A	6: 125,364,629		probably null	Het
Ppox	T	C	1: 171,277,749	Y321C	probably damaging	Het
Pxdn	A	G	12: 29,987,066	N281S	possibly damaging	Het
Pycrl	A	T	15: 75,918,388	M138K	probably benign	Het
Radil	T	C	5: 142,497,873	Y526C	probably damaging	Het
Ranbp3	C	A	17: 56,707,169	D233E	probably benign	Het
Rhpn1	A	G	15: 75,711,872	Q402R	possibly damaging	Het
Sec23b	T	A	2: 144,568,612		probably benign	Het
Sel1l2	A	T	2: 140,240,912	L602*	probably null	Het
Sema5b	G	A	16: 35,646,355	G209D	probably damaging	Het
Svep1	T	C	4: 58,073,333	Y1992C	possibly damaging	Het
Syncrip	T	A	9: 88,456,259		probably benign	Het
Synj1	G	T	16: 90,967,354	A65E	probably damaging	Het
Taar2	G	A	10: 23,941,495	R311H	probably benign	Het
Tecrl	T	C	5: 83,354,763		probably benign	Het
Tenm4	G	T	7: 96,777,851	G698C	probably damaging	Het
Tmem209	G	A	6: 30,491,182	L259F	probably damaging	Het
Tmem247	G	A	17: 86,918,503	E124K	possibly damaging	Het
Tnks2	C	A	19: 36,852,821	A218E	probably damaging	Het
Tppp	T	A	13: 74,021,311	F57I	probably damaging	Het
Trim36	A	G	18: 46,172,525	W452R	probably damaging	Het
Vars2	A	T	17: 35,664,584	V262E	probably damaging	Het
Vmn2r92	C	T	17: 18,167,957	A408V	probably damaging	Het
Zfp516	G	T	18: 82,955,772	A32S	probably benign	Het
Zfy2	G	T	Y: 2,107,348	L429I	possibly damaging	Het

Other mutations in Arhgef12

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00923:Arhgef12	APN	9	43020624	missense	probably damaging	1.00
IGL00942:Arhgef12	APN	9	42982000	missense	probably damaging	1.00
IGL01529:Arhgef12	APN	9	42990055	missense	probably damaging	1.00
IGL01845:Arhgef12	APN	9	43022841	missense	possibly damaging	0.56
IGL02039:Arhgef12	APN	9	42972267	missense	probably benign
IGL02135:Arhgef12	APN	9	42972165	missense	possibly damaging	0.68
IGL02272:Arhgef12	APN	9	43001452	missense	probably damaging	1.00
IGL02498:Arhgef12	APN	9	42982043	missense	probably benign	0.19
IGL02507:Arhgef12	APN	9	42992563	missense	probably damaging	1.00
IGL02574:Arhgef12	APN	9	43005623	missense	probably damaging	0.99
IGL02586:Arhgef12	APN	9	43005904	nonsense	probably null
IGL02803:Arhgef12	APN	9	42972028	missense	possibly damaging	0.48
IGL02892:Arhgef12	APN	9	43000972	missense	possibly damaging	0.79
IGL02937:Arhgef12	APN	9	43015920	missense	probably damaging	0.97
IGL02992:Arhgef12	APN	9	42999077	missense	probably damaging	1.00
IGL03028:Arhgef12	APN	9	43026228	missense	possibly damaging	0.84
IGL03146:Arhgef12	APN	9	42974570	missense	possibly damaging	0.90
IGL03193:Arhgef12	APN	9	42992533	splice site	probably benign
IGL03398:Arhgef12	APN	9	42978226	missense	probably damaging	1.00
R0019:Arhgef12	UTSW	9	42978233	missense	probably damaging	1.00
R0143:Arhgef12	UTSW	9	43005594	missense	probably damaging	1.00
R0211:Arhgef12	UTSW	9	42972004	missense	probably damaging	0.97
R0330:Arhgef12	UTSW	9	43020686	missense	probably damaging	0.97
R0364:Arhgef12	UTSW	9	43018401	missense	probably damaging	0.99
R0658:Arhgef12	UTSW	9	42981985	missense	probably damaging	1.00
R0686:Arhgef12	UTSW	9	42993028	missense	probably benign	0.02
R0693:Arhgef12	UTSW	9	43018401	missense	probably damaging	0.99
R0990:Arhgef12	UTSW	9	42972381	missense	probably benign	0.00
R1147:Arhgef12	UTSW	9	43044256	unclassified	probably benign
R1395:Arhgef12	UTSW	9	43005870	missense	probably damaging	1.00
R1419:Arhgef12	UTSW	9	43027220	missense	probably damaging	1.00
R1451:Arhgef12	UTSW	9	42992578	splice site	probably benign
R1458:Arhgef12	UTSW	9	42988998	missense	probably damaging	0.98
R1654:Arhgef12	UTSW	9	42997660	missense	possibly damaging	0.83
R1722:Arhgef12	UTSW	9	43020717	makesense	probably null
R1773:Arhgef12	UTSW	9	43005542	critical splice donor site	probably null
R1895:Arhgef12	UTSW	9	43005856	missense	probably damaging	1.00
R2109:Arhgef12	UTSW	9	42979472	missense	possibly damaging	0.75
R2215:Arhgef12	UTSW	9	43005871	missense	probably damaging	1.00
R2421:Arhgef12	UTSW	9	43001006	missense	probably damaging	1.00
R3967:Arhgef12	UTSW	9	43005551	missense	probably damaging	1.00
R3968:Arhgef12	UTSW	9	43005551	missense	probably damaging	1.00
R3969:Arhgef12	UTSW	9	43005551	missense	probably damaging	1.00
R4077:Arhgef12	UTSW	9	42975292	missense	probably damaging	0.99
R4079:Arhgef12	UTSW	9	42975292	missense	probably damaging	0.99
R4111:Arhgef12	UTSW	9	42972274	missense	probably damaging	1.00
R4302:Arhgef12	UTSW	9	43018349	nonsense	probably null
R4327:Arhgef12	UTSW	9	42975229	nonsense	probably null
R4462:Arhgef12	UTSW	9	42981982	missense	probably damaging	1.00
R4583:Arhgef12	UTSW	9	42977662	missense	probably damaging	1.00
R4603:Arhgef12	UTSW	9	43010193	missense	probably benign	0.27
R4650:Arhgef12	UTSW	9	42981970	missense	probably damaging	1.00
R4741:Arhgef12	UTSW	9	42972153	missense	possibly damaging	0.54
R4823:Arhgef12	UTSW	9	43020696	missense	probably benign
R4840:Arhgef12	UTSW	9	42975068	missense	probably benign	0.04
R4912:Arhgef12	UTSW	9	42993065	nonsense	probably null
R5176:Arhgef12	UTSW	9	43020686	missense	probably damaging	0.97
R5426:Arhgef12	UTSW	9	42986584	missense	probably damaging	1.00
R5579:Arhgef12	UTSW	9	43010193	missense	probably benign	0.27
R5838:Arhgef12	UTSW	9	43005608	missense	probably damaging	1.00
R6230:Arhgef12	UTSW	9	42988965	missense	probably benign	0.04
R6741:Arhgef12	UTSW	9	42972207	missense	probably benign	0.05
R6959:Arhgef12	UTSW	9	43015953	missense	probably benign
R7252:Arhgef12	UTSW	9	43015909	missense	probably benign	0.17
R7470:Arhgef12	UTSW	9	43040552	missense	probably damaging	1.00
R7658:Arhgef12	UTSW	9	42992536	missense	probably damaging	1.00
R7724:Arhgef12	UTSW	9	43027271	missense	probably damaging	1.00
R7980:Arhgef12	UTSW	9	42971299	nonsense	probably null
R8074:Arhgef12	UTSW	9	42971103	nonsense	probably null
R8155:Arhgef12	UTSW	9	43042662	missense	probably damaging	1.00
R8270:Arhgef12	UTSW	9	42971058	missense	probably benign
R8407:Arhgef12	UTSW	9	43026179	critical splice donor site	probably null
R8527:Arhgef12	UTSW	9	42997648	missense	possibly damaging	0.95
R9116:Arhgef12	UTSW	9	42981945	splice site	probably benign
R9127:Arhgef12	UTSW	9	42974574	missense	possibly damaging	0.94
R9602:Arhgef12	UTSW	9	42984380	missense	probably damaging	1.00
R9665:Arhgef12	UTSW	9	43018354	missense	possibly damaging	0.89
R9733:Arhgef12	UTSW	9	42989998	nonsense	probably null
R9735:Arhgef12	UTSW	9	42971103	nonsense	probably null
R9760:Arhgef12	UTSW	9	42992022	missense	probably damaging	1.00
RF020:Arhgef12	UTSW	9	42989989	missense	possibly damaging	0.75
Z1176:Arhgef12	UTSW	9	42971072	missense	probably benign	0.00
Z1186:Arhgef12	UTSW	9	43000015	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGATTGACAGCCACGAAAGCCC -3'
(R):5'- AGCAACATTCCCCTCAGAATGTGC -3'

Sequencing Primer
(F):5'- TGGAAACCAACTGACCCAGTATTTAG -3'
(R):5'- GTTTCACCATTCACCCCAGA -3'

Posted On

2013-05-23