Incidental Mutation 'R0426:Arhgef12'
ID 38659
Institutional Source Beutler Lab
Gene Symbol Arhgef12
Ensembl Gene ENSMUSG00000059495
Gene Name Rho guanine nucleotide exchange factor (GEF) 12
Synonyms LARG, 2310014B11Rik
MMRRC Submission 038628-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.950) question?
Stock # R0426 (G1)
Quality Score 225
Status Validated
Chromosome 9
Chromosomal Location 42963842-43107239 bp(-) (GRCm38)
Type of Mutation splice site (3 bp from exon)
DNA Base Change (assembly) T to C at 42970990 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000126598 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072767] [ENSMUST00000165665]
AlphaFold Q8R4H2
Predicted Effect probably null
Transcript: ENSMUST00000072767
SMART Domains Protein: ENSMUSP00000072547
Gene: ENSMUSG00000059495

DomainStartEndE-ValueType
low complexity region 49 64 N/A INTRINSIC
PDZ 80 148 1.64e-19 SMART
coiled coil region 196 259 N/A INTRINSIC
low complexity region 293 313 N/A INTRINSIC
Pfam:RGS-like 368 558 8.6e-87 PFAM
low complexity region 583 596 N/A INTRINSIC
low complexity region 663 676 N/A INTRINSIC
low complexity region 721 733 N/A INTRINSIC
RhoGEF 791 976 6.35e-66 SMART
PH 1020 1134 6.26e-6 SMART
low complexity region 1256 1269 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000165665
SMART Domains Protein: ENSMUSP00000126598
Gene: ENSMUSG00000059495

DomainStartEndE-ValueType
low complexity region 49 64 N/A INTRINSIC
PDZ 80 148 1.64e-19 SMART
coiled coil region 196 259 N/A INTRINSIC
low complexity region 293 313 N/A INTRINSIC
Pfam:RGS-like 369 559 1.6e-88 PFAM
low complexity region 584 597 N/A INTRINSIC
low complexity region 664 677 N/A INTRINSIC
low complexity region 722 734 N/A INTRINSIC
RhoGEF 792 977 6.35e-66 SMART
PH 1021 1135 6.26e-6 SMART
low complexity region 1257 1270 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216016
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.9%
Validation Efficiency 96% (86/90)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Rho GTPases play a fundamental role in numerous cellular processes that are initiated by extracellular stimuli working through G protein-coupled receptors. The encoded protein may form a complex with G proteins and stimulate Rho-dependent signals. This protein has been observed to form a myeloid/lymphoid fusion partner in acute myeloid leukemia. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a null allele exhibit decreased sensitivity to certain vasoconstrictors and resistance to salt-induced hypertension. Mice homozygous for a different knock-out allele exhibit partial prenatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830010M20Rik C T 5: 107,510,373 T1603I probably damaging Het
Abca8b G T 11: 109,955,027 probably benign Het
Acadl A T 1: 66,841,646 F320L probably damaging Het
Acsbg1 T C 9: 54,622,746 D222G probably benign Het
Anapc15 A G 7: 101,898,033 T39A probably benign Het
Ano3 A T 2: 110,661,174 V919E probably damaging Het
Atad5 T A 11: 80,112,832 I1091N probably benign Het
Atf1 A T 15: 100,232,827 H26L possibly damaging Het
Atp10a T C 7: 58,784,734 M252T probably benign Het
Cd55 C T 1: 130,448,372 R347H probably benign Het
Cdc27 A C 11: 104,513,027 probably null Het
Cdh9 G A 15: 16,823,454 probably null Het
Cdk11b T C 4: 155,642,512 probably benign Het
Cep70 A G 9: 99,297,684 D567G probably benign Het
Cep78 A T 19: 15,970,970 Y382* probably null Het
Col9a2 T C 4: 121,044,660 probably benign Het
Cyp2d12 G A 15: 82,558,963 D409N probably benign Het
Ddx39 A G 8: 83,721,769 T217A probably benign Het
Dennd1b T A 1: 139,170,196 D733E probably benign Het
Dicer1 A G 12: 104,702,542 S1294P probably damaging Het
Dnah3 T C 7: 119,943,572 E3539G probably benign Het
Dnmbp A G 19: 43,852,436 probably benign Het
Dysf T C 6: 84,149,757 L1332P probably damaging Het
F5 A G 1: 164,182,840 D380G probably damaging Het
Fam160a2 A C 7: 105,389,473 C186W probably damaging Het
Fam171a1 T C 2: 3,225,396 V522A probably benign Het
Galr2 C A 11: 116,281,691 A69D probably damaging Het
Grk2 T C 19: 4,290,600 probably null Het
Gtf3c1 A T 7: 125,663,016 Y1119* probably null Het
Hgd A T 16: 37,588,685 probably benign Het
Ildr2 G T 1: 166,308,899 V436L probably benign Het
Intu G A 3: 40,675,305 C355Y probably damaging Het
Irf2bpl G T 12: 86,883,096 P268T probably benign Het
Jarid2 T C 13: 44,840,882 probably null Het
Jup A T 11: 100,372,401 M716K probably benign Het
Kank1 G A 19: 25,411,473 V809I probably damaging Het
Kdm1b T A 13: 47,064,244 probably benign Het
Kdm3a C T 6: 71,600,755 C687Y probably damaging Het
Kdm5d T A Y: 942,437 probably benign Het
Kifap3 T A 1: 163,865,552 probably benign Het
Macf1 T A 4: 123,483,660 K1400* probably null Het
Majin A G 19: 6,212,117 probably benign Het
Mb21d1 G A 9: 78,435,738 probably benign Het
Mctp1 A G 13: 77,020,821 I846V probably benign Het
Mrgpra2b T A 7: 47,464,127 I286F possibly damaging Het
Neil3 T G 8: 53,609,396 probably benign Het
Nox3 G T 17: 3,695,563 N23K probably damaging Het
Nt5c3 T C 6: 56,883,812 K219E probably benign Het
Olfr1458 G A 19: 13,103,278 R3C possibly damaging Het
Olfr213 A T 6: 116,540,485 N11Y probably damaging Het
Olfr389 T A 11: 73,776,437 M297L probably benign Het
Olfr524 A C 7: 140,202,116 F218C possibly damaging Het
Olfr548-ps1 T A 7: 102,542,686 I250N probably damaging Het
Olfr954 T C 9: 39,461,593 L54P probably damaging Het
Pacsin2 A G 15: 83,379,795 V347A possibly damaging Het
Pcdhb7 A T 18: 37,342,804 E331V probably damaging Het
Pcid2 A C 8: 13,081,262 probably null Het
Pcsk9 T C 4: 106,450,077 D323G possibly damaging Het
Pdhb T C 14: 8,169,801 E203G probably damaging Het
Phlpp2 A G 8: 109,928,463 Y630C probably benign Het
Pidd1 C T 7: 141,439,133 A812T probably damaging Het
Plau G A 14: 20,842,314 R389H probably benign Het
Plekhg6 G A 6: 125,364,629 probably null Het
Ppox T C 1: 171,277,749 Y321C probably damaging Het
Pxdn A G 12: 29,987,066 N281S possibly damaging Het
Pycrl A T 15: 75,918,388 M138K probably benign Het
Radil T C 5: 142,497,873 Y526C probably damaging Het
Ranbp3 C A 17: 56,707,169 D233E probably benign Het
Rhpn1 A G 15: 75,711,872 Q402R possibly damaging Het
Sec23b T A 2: 144,568,612 probably benign Het
Sel1l2 A T 2: 140,240,912 L602* probably null Het
Sema5b G A 16: 35,646,355 G209D probably damaging Het
Svep1 T C 4: 58,073,333 Y1992C possibly damaging Het
Syncrip T A 9: 88,456,259 probably benign Het
Synj1 G T 16: 90,967,354 A65E probably damaging Het
Taar2 G A 10: 23,941,495 R311H probably benign Het
Tecrl T C 5: 83,354,763 probably benign Het
Tenm4 G T 7: 96,777,851 G698C probably damaging Het
Tmem209 G A 6: 30,491,182 L259F probably damaging Het
Tmem247 G A 17: 86,918,503 E124K possibly damaging Het
Tnks2 C A 19: 36,852,821 A218E probably damaging Het
Tppp T A 13: 74,021,311 F57I probably damaging Het
Trim36 A G 18: 46,172,525 W452R probably damaging Het
Vars2 A T 17: 35,664,584 V262E probably damaging Het
Vmn2r92 C T 17: 18,167,957 A408V probably damaging Het
Zfp516 G T 18: 82,955,772 A32S probably benign Het
Zfy2 G T Y: 2,107,348 L429I possibly damaging Het
Other mutations in Arhgef12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00923:Arhgef12 APN 9 43020624 missense probably damaging 1.00
IGL00942:Arhgef12 APN 9 42982000 missense probably damaging 1.00
IGL01529:Arhgef12 APN 9 42990055 missense probably damaging 1.00
IGL01845:Arhgef12 APN 9 43022841 missense possibly damaging 0.56
IGL02039:Arhgef12 APN 9 42972267 missense probably benign
IGL02135:Arhgef12 APN 9 42972165 missense possibly damaging 0.68
IGL02272:Arhgef12 APN 9 43001452 missense probably damaging 1.00
IGL02498:Arhgef12 APN 9 42982043 missense probably benign 0.19
IGL02507:Arhgef12 APN 9 42992563 missense probably damaging 1.00
IGL02574:Arhgef12 APN 9 43005623 missense probably damaging 0.99
IGL02586:Arhgef12 APN 9 43005904 nonsense probably null
IGL02803:Arhgef12 APN 9 42972028 missense possibly damaging 0.48
IGL02892:Arhgef12 APN 9 43000972 missense possibly damaging 0.79
IGL02937:Arhgef12 APN 9 43015920 missense probably damaging 0.97
IGL02992:Arhgef12 APN 9 42999077 missense probably damaging 1.00
IGL03028:Arhgef12 APN 9 43026228 missense possibly damaging 0.84
IGL03146:Arhgef12 APN 9 42974570 missense possibly damaging 0.90
IGL03193:Arhgef12 APN 9 42992533 splice site probably benign
IGL03398:Arhgef12 APN 9 42978226 missense probably damaging 1.00
R0019:Arhgef12 UTSW 9 42978233 missense probably damaging 1.00
R0143:Arhgef12 UTSW 9 43005594 missense probably damaging 1.00
R0211:Arhgef12 UTSW 9 42972004 missense probably damaging 0.97
R0330:Arhgef12 UTSW 9 43020686 missense probably damaging 0.97
R0364:Arhgef12 UTSW 9 43018401 missense probably damaging 0.99
R0658:Arhgef12 UTSW 9 42981985 missense probably damaging 1.00
R0686:Arhgef12 UTSW 9 42993028 missense probably benign 0.02
R0693:Arhgef12 UTSW 9 43018401 missense probably damaging 0.99
R0990:Arhgef12 UTSW 9 42972381 missense probably benign 0.00
R1147:Arhgef12 UTSW 9 43044256 unclassified probably benign
R1395:Arhgef12 UTSW 9 43005870 missense probably damaging 1.00
R1419:Arhgef12 UTSW 9 43027220 missense probably damaging 1.00
R1451:Arhgef12 UTSW 9 42992578 splice site probably benign
R1458:Arhgef12 UTSW 9 42988998 missense probably damaging 0.98
R1654:Arhgef12 UTSW 9 42997660 missense possibly damaging 0.83
R1722:Arhgef12 UTSW 9 43020717 makesense probably null
R1773:Arhgef12 UTSW 9 43005542 critical splice donor site probably null
R1895:Arhgef12 UTSW 9 43005856 missense probably damaging 1.00
R2109:Arhgef12 UTSW 9 42979472 missense possibly damaging 0.75
R2215:Arhgef12 UTSW 9 43005871 missense probably damaging 1.00
R2421:Arhgef12 UTSW 9 43001006 missense probably damaging 1.00
R3967:Arhgef12 UTSW 9 43005551 missense probably damaging 1.00
R3968:Arhgef12 UTSW 9 43005551 missense probably damaging 1.00
R3969:Arhgef12 UTSW 9 43005551 missense probably damaging 1.00
R4077:Arhgef12 UTSW 9 42975292 missense probably damaging 0.99
R4079:Arhgef12 UTSW 9 42975292 missense probably damaging 0.99
R4111:Arhgef12 UTSW 9 42972274 missense probably damaging 1.00
R4302:Arhgef12 UTSW 9 43018349 nonsense probably null
R4327:Arhgef12 UTSW 9 42975229 nonsense probably null
R4462:Arhgef12 UTSW 9 42981982 missense probably damaging 1.00
R4583:Arhgef12 UTSW 9 42977662 missense probably damaging 1.00
R4603:Arhgef12 UTSW 9 43010193 missense probably benign 0.27
R4650:Arhgef12 UTSW 9 42981970 missense probably damaging 1.00
R4741:Arhgef12 UTSW 9 42972153 missense possibly damaging 0.54
R4823:Arhgef12 UTSW 9 43020696 missense probably benign
R4840:Arhgef12 UTSW 9 42975068 missense probably benign 0.04
R4912:Arhgef12 UTSW 9 42993065 nonsense probably null
R5176:Arhgef12 UTSW 9 43020686 missense probably damaging 0.97
R5426:Arhgef12 UTSW 9 42986584 missense probably damaging 1.00
R5579:Arhgef12 UTSW 9 43010193 missense probably benign 0.27
R5838:Arhgef12 UTSW 9 43005608 missense probably damaging 1.00
R6230:Arhgef12 UTSW 9 42988965 missense probably benign 0.04
R6741:Arhgef12 UTSW 9 42972207 missense probably benign 0.05
R6959:Arhgef12 UTSW 9 43015953 missense probably benign
R7252:Arhgef12 UTSW 9 43015909 missense probably benign 0.17
R7470:Arhgef12 UTSW 9 43040552 missense probably damaging 1.00
R7658:Arhgef12 UTSW 9 42992536 missense probably damaging 1.00
R7724:Arhgef12 UTSW 9 43027271 missense probably damaging 1.00
R7980:Arhgef12 UTSW 9 42971299 nonsense probably null
R8074:Arhgef12 UTSW 9 42971103 nonsense probably null
R8155:Arhgef12 UTSW 9 43042662 missense probably damaging 1.00
R8270:Arhgef12 UTSW 9 42971058 missense probably benign
R8407:Arhgef12 UTSW 9 43026179 critical splice donor site probably null
R8527:Arhgef12 UTSW 9 42997648 missense possibly damaging 0.95
R9127:Arhgef12 UTSW 9 42974574 missense possibly damaging 0.94
R9602:Arhgef12 UTSW 9 42984380 missense probably damaging 1.00
RF020:Arhgef12 UTSW 9 42989989 missense possibly damaging 0.75
Z1176:Arhgef12 UTSW 9 42971072 missense probably benign 0.00
Z1186:Arhgef12 UTSW 9 43000015 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGATTGACAGCCACGAAAGCCC -3'
(R):5'- AGCAACATTCCCCTCAGAATGTGC -3'

Sequencing Primer
(F):5'- TGGAAACCAACTGACCCAGTATTTAG -3'
(R):5'- GTTTCACCATTCACCCCAGA -3'
Posted On 2013-05-23