Incidental Mutation 'R0426:Syncrip'
ID38662
Institutional Source Beutler Lab
Gene Symbol Syncrip
Ensembl Gene ENSMUSG00000032423
Gene Namesynaptotagmin binding, cytoplasmic RNA interacting protein
SynonymshnRNP Q, GRY-RBP, Nsap1, pp68, RRM RNA binding protein GRY-RBP, Nsap1l, 2610109K23Rik, 4632417O19Rik
MMRRC Submission 038628-MU
Accession Numbers

Genbank: NM_019666NM_019796; MGI: 1891690

 

Is this an essential gene? Possibly essential (E-score: 0.741) question?
Stock #R0426 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location88447009-88482574 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to A at 88456259 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000133716 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069221] [ENSMUST00000172828] [ENSMUST00000173801] [ENSMUST00000174269] [ENSMUST00000174282] [ENSMUST00000174361] [ENSMUST00000174391] [ENSMUST00000174688]
Predicted Effect probably benign
Transcript: ENSMUST00000069221
SMART Domains Protein: ENSMUSP00000063744
Gene: ENSMUSG00000032423

DomainStartEndE-ValueType
RRM 163 237 3.38e-21 SMART
RRM 244 321 2.1e-8 SMART
RRM 339 404 1.4e-18 SMART
low complexity region 428 490 N/A INTRINSIC
low complexity region 494 522 N/A INTRINSIC
low complexity region 526 553 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000154586
SMART Domains Protein: ENSMUSP00000133964
Gene: ENSMUSG00000092541

DomainStartEndE-ValueType
low complexity region 1 20 N/A INTRINSIC
low complexity region 24 50 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172828
Predicted Effect probably benign
Transcript: ENSMUST00000173131
SMART Domains Protein: ENSMUSP00000134122
Gene: ENSMUSG00000092541

DomainStartEndE-ValueType
low complexity region 1 26 N/A INTRINSIC
low complexity region 30 58 N/A INTRINSIC
low complexity region 62 88 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000173801
AA Change: N584I
SMART Domains Protein: ENSMUSP00000133649
Gene: ENSMUSG00000032423
AA Change: N584I

DomainStartEndE-ValueType
RRM 163 237 3.38e-21 SMART
RRM 244 321 2.1e-8 SMART
RRM 339 404 1.4e-18 SMART
low complexity region 428 490 N/A INTRINSIC
low complexity region 494 522 N/A INTRINSIC
low complexity region 526 563 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174269
SMART Domains Protein: ENSMUSP00000134506
Gene: ENSMUSG00000032423

DomainStartEndE-ValueType
RRM 163 237 3.38e-21 SMART
RRM 244 303 2.77e0 SMART
RRM 304 369 1.4e-18 SMART
low complexity region 393 455 N/A INTRINSIC
low complexity region 459 487 N/A INTRINSIC
low complexity region 491 518 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174282
SMART Domains Protein: ENSMUSP00000134071
Gene: ENSMUSG00000032423

DomainStartEndE-ValueType
RRM 163 237 1.4e-23 SMART
RRM 244 321 9.1e-11 SMART
RRM 339 404 6e-21 SMART
low complexity region 428 490 N/A INTRINSIC
low complexity region 494 522 N/A INTRINSIC
low complexity region 526 552 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000174361
AA Change: N549I
SMART Domains Protein: ENSMUSP00000134722
Gene: ENSMUSG00000032423
AA Change: N549I

DomainStartEndE-ValueType
RRM 163 237 3.38e-21 SMART
RRM 244 303 2.77e0 SMART
RRM 304 369 1.4e-18 SMART
low complexity region 393 455 N/A INTRINSIC
low complexity region 459 487 N/A INTRINSIC
low complexity region 491 528 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174391
SMART Domains Protein: ENSMUSP00000134342
Gene: ENSMUSG00000032423

DomainStartEndE-ValueType
RRM 65 139 3.38e-21 SMART
RRM 146 223 2.1e-8 SMART
RRM 241 306 1.4e-18 SMART
low complexity region 330 392 N/A INTRINSIC
low complexity region 396 424 N/A INTRINSIC
low complexity region 428 455 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174688
SMART Domains Protein: ENSMUSP00000133716
Gene: ENSMUSG00000032423

DomainStartEndE-ValueType
RRM 163 224 3.18e-8 SMART
RRM 225 290 1.4e-18 SMART
low complexity region 314 376 N/A INTRINSIC
low complexity region 380 408 N/A INTRINSIC
low complexity region 412 439 N/A INTRINSIC
Meta Mutation Damage Score 0.1068 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.9%
Validation Efficiency 96% (86/90)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cellular heterogeneous nuclear ribonucleoprotein (hnRNP) family. hnRNPs are RNA binding proteins that complex with heterogeneous nuclear RNA (hnRNA) and regulate alternative splicing, polyadenylation, and other aspects of mRNA metabolism and transport. The encoded protein plays a role in multiple aspects of mRNA maturation and is associated with several multiprotein complexes including the apoB RNA editing-complex and survival of motor neurons (SMN) complex. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene, and a pseudogene of this gene is located on the short arm of chromosome 20. [provided by RefSeq, Dec 2011]
Allele List at MGI

 All alleles(28) : Gene trapped(28)

Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830010M20Rik C T 5: 107,510,373 T1603I probably damaging Het
Abca8b G T 11: 109,955,027 probably benign Het
Acadl A T 1: 66,841,646 F320L probably damaging Het
Acsbg1 T C 9: 54,622,746 D222G probably benign Het
Anapc15 A G 7: 101,898,033 T39A probably benign Het
Ano3 A T 2: 110,661,174 V919E probably damaging Het
Arhgef12 T C 9: 42,970,990 probably null Het
Atad5 T A 11: 80,112,832 I1091N probably benign Het
Atf1 A T 15: 100,232,827 H26L possibly damaging Het
Atp10a T C 7: 58,784,734 M252T probably benign Het
Cd55 C T 1: 130,448,372 R347H probably benign Het
Cdc27 A C 11: 104,513,027 probably null Het
Cdh9 G A 15: 16,823,454 probably null Het
Cdk11b T C 4: 155,642,512 probably benign Het
Cep70 A G 9: 99,297,684 D567G probably benign Het
Cep78 A T 19: 15,970,970 Y382* probably null Het
Col9a2 T C 4: 121,044,660 probably benign Het
Cyp2d12 G A 15: 82,558,963 D409N probably benign Het
Ddx39 A G 8: 83,721,769 T217A probably benign Het
Dennd1b T A 1: 139,170,196 D733E probably benign Het
Dicer1 A G 12: 104,702,542 S1294P probably damaging Het
Dnah3 T C 7: 119,943,572 E3539G probably benign Het
Dnmbp A G 19: 43,852,436 probably benign Het
Dysf T C 6: 84,149,757 L1332P probably damaging Het
F5 A G 1: 164,182,840 D380G probably damaging Het
Fam160a2 A C 7: 105,389,473 C186W probably damaging Het
Fam171a1 T C 2: 3,225,396 V522A probably benign Het
Galr2 C A 11: 116,281,691 A69D probably damaging Het
Grk2 T C 19: 4,290,600 probably null Het
Gtf3c1 A T 7: 125,663,016 Y1119* probably null Het
Hgd A T 16: 37,588,685 probably benign Het
Ildr2 G T 1: 166,308,899 V436L probably benign Het
Intu G A 3: 40,675,305 C355Y probably damaging Het
Irf2bpl G T 12: 86,883,096 P268T probably benign Het
Jarid2 T C 13: 44,840,882 probably null Het
Jup A T 11: 100,372,401 M716K probably benign Het
Kank1 G A 19: 25,411,473 V809I probably damaging Het
Kdm1b T A 13: 47,064,244 probably benign Het
Kdm3a C T 6: 71,600,755 C687Y probably damaging Het
Kdm5d T A Y: 942,437 probably benign Het
Kifap3 T A 1: 163,865,552 probably benign Het
Macf1 T A 4: 123,483,660 K1400* probably null Het
Majin A G 19: 6,212,117 probably benign Het
Mb21d1 G A 9: 78,435,738 probably benign Het
Mctp1 A G 13: 77,020,821 I846V probably benign Het
Mrgpra2b T A 7: 47,464,127 I286F possibly damaging Het
Neil3 T G 8: 53,609,396 probably benign Het
Nox3 G T 17: 3,695,563 N23K probably damaging Het
Nt5c3 T C 6: 56,883,812 K219E probably benign Het
Olfr1458 G A 19: 13,103,278 R3C possibly damaging Het
Olfr213 A T 6: 116,540,485 N11Y probably damaging Het
Olfr389 T A 11: 73,776,437 M297L probably benign Het
Olfr524 A C 7: 140,202,116 F218C possibly damaging Het
Olfr548-ps1 T A 7: 102,542,686 I250N probably damaging Het
Olfr954 T C 9: 39,461,593 L54P probably damaging Het
Pacsin2 A G 15: 83,379,795 V347A possibly damaging Het
Pcdhb7 A T 18: 37,342,804 E331V probably damaging Het
Pcid2 A C 8: 13,081,262 probably null Het
Pcsk9 T C 4: 106,450,077 D323G possibly damaging Het
Pdhb T C 14: 8,169,801 E203G probably damaging Het
Phlpp2 A G 8: 109,928,463 Y630C probably benign Het
Pidd1 C T 7: 141,439,133 A812T probably damaging Het
Plau G A 14: 20,842,314 R389H probably benign Het
Plekhg6 G A 6: 125,364,629 probably null Het
Ppox T C 1: 171,277,749 Y321C probably damaging Het
Pxdn A G 12: 29,987,066 N281S possibly damaging Het
Pycrl A T 15: 75,918,388 M138K probably benign Het
Radil T C 5: 142,497,873 Y526C probably damaging Het
Ranbp3 C A 17: 56,707,169 D233E probably benign Het
Rhpn1 A G 15: 75,711,872 Q402R possibly damaging Het
Sec23b T A 2: 144,568,612 probably benign Het
Sel1l2 A T 2: 140,240,912 L602* probably null Het
Sema5b G A 16: 35,646,355 G209D probably damaging Het
Svep1 T C 4: 58,073,333 Y1992C possibly damaging Het
Synj1 G T 16: 90,967,354 A65E probably damaging Het
Taar2 G A 10: 23,941,495 R311H probably benign Het
Tecrl T C 5: 83,354,763 probably benign Het
Tenm4 G T 7: 96,777,851 G698C probably damaging Het
Tmem209 G A 6: 30,491,182 L259F probably damaging Het
Tmem247 G A 17: 86,918,503 E124K possibly damaging Het
Tnks2 C A 19: 36,852,821 A218E probably damaging Het
Tppp T A 13: 74,021,311 F57I probably damaging Het
Trim36 A G 18: 46,172,525 W452R probably damaging Het
Vars2 A T 17: 35,664,584 V262E probably damaging Het
Vmn2r92 C T 17: 18,167,957 A408V probably damaging Het
Zfp516 G T 18: 82,955,772 A32S probably benign Het
Zfy2 G T Y: 2,107,348 L429I possibly damaging Het
Other mutations in Syncrip
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01287:Syncrip APN 9 88456607 utr 3 prime probably benign
IGL01474:Syncrip APN 9 88480747 missense probably benign 0.04
IGL02657:Syncrip APN 9 88456404 missense probably benign 0.23
IGL02659:Syncrip APN 9 88456404 missense probably benign 0.23
IGL02660:Syncrip APN 9 88456404 missense probably benign 0.23
IGL02699:Syncrip APN 9 88456554 utr 3 prime probably benign
IGL02727:Syncrip APN 9 88479879 missense probably damaging 1.00
IGL02801:Syncrip APN 9 88479809 missense probably damaging 1.00
IGL03169:Syncrip APN 9 88456443 utr 3 prime probably benign
IGL03214:Syncrip APN 9 88464643 intron probably benign
3-1:Syncrip UTSW 9 88461674 nonsense probably null
R1500:Syncrip UTSW 9 88479896 missense probably damaging 0.98
R1952:Syncrip UTSW 9 88476874 missense probably damaging 1.00
R2437:Syncrip UTSW 9 88479567 splice site probably benign
R3715:Syncrip UTSW 9 88479685 splice site probably benign
R3779:Syncrip UTSW 9 88476939 missense probably damaging 1.00
R4770:Syncrip UTSW 9 88479852 missense probably damaging 1.00
R5677:Syncrip UTSW 9 88456709 unclassified probably benign
R6860:Syncrip UTSW 9 88476796 missense probably damaging 0.98
R7286:Syncrip UTSW 9 88464663 missense probably damaging 1.00
R7736:Syncrip UTSW 9 88461668 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GCTTTGTTCATGTCCAAGCGGATTG -3'
(R):5'- TTATTCACAGAGAGGAGGCCCTGG -3'

Sequencing Primer
(F):5'- GATGTCTCAAATTACAGTGGCACC -3'
(R):5'- TGGATCAGCAAGAGGCGTTC -3'
Posted On2013-05-23