Incidental Mutation 'R5061:Tll1'
ID386621
Institutional Source Beutler Lab
Gene Symbol Tll1
Ensembl Gene ENSMUSG00000053626
Gene Nametolloid-like
SynonymsTll-1
MMRRC Submission 042651-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5061 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location64014931-64206271 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 64053949 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Phenylalanine at position 586 (C586F)
Ref Sequence ENSEMBL: ENSMUSP00000070560 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066166]
Predicted Effect probably damaging
Transcript: ENSMUST00000066166
AA Change: C586F

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000070560
Gene: ENSMUSG00000053626
AA Change: C586F

DomainStartEndE-ValueType
ZnMc 153 295 4.12e-56 SMART
CUB 349 461 4.12e-44 SMART
CUB 462 574 3.81e-48 SMART
EGF_CA 574 615 2.28e-9 SMART
CUB 618 730 9.11e-46 SMART
EGF_CA 730 770 4.25e-9 SMART
CUB 774 886 2.01e-47 SMART
CUB 887 1003 7.19e-35 SMART
Meta Mutation Damage Score 0.9315 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.7%
Validation Efficiency 100% (71/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an astacin-like, zinc-dependent, metalloprotease that belongs to the peptidase M12A family. This protease processes procollagen C-propeptides, such as chordin, pro-biglycan and pro-lysyl oxidase. Studies in mice suggest that this gene plays multiple roles in the development of mammalian heart, and is essential for the formation of the interventricular septum. Allelic variants of this gene are associated with atrial septal defect type 6. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2011]
PHENOTYPE: Homozygous null mice are embryonic lethal with death at midgestation from cardiac failure. Cardiac defects include incomplete formation of the ventricular septum and abnormal positioning of the heart and aorta. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700009N14Rik A G 4: 39,450,953 H53R probably benign Het
Abcg1 A G 17: 31,092,392 K124E probably damaging Het
Acot4 G T 12: 84,038,701 R64L probably benign Het
Adam22 G C 5: 8,180,238 probably benign Het
Add2 G A 6: 86,087,047 probably null Het
Adgrb3 G A 1: 25,068,128 probably benign Het
Akap8l T G 17: 32,332,894 K441T probably damaging Het
Aspn T A 13: 49,566,604 S365R probably damaging Het
Atxn1 T G 13: 45,557,093 K788Q probably damaging Het
Atxn2l G T 7: 126,500,203 H135N probably damaging Het
Borcs8 T G 8: 70,140,358 probably null Het
Col5a1 G A 2: 27,952,378 D422N unknown Het
Cstad A T 2: 30,608,263 T37S unknown Het
Dgkq A T 5: 108,654,123 D455E probably benign Het
Dopey1 T C 9: 86,503,108 probably benign Het
Ebf3 T C 7: 137,313,559 I84V possibly damaging Het
Ehmt2 C T 17: 34,899,091 R40* probably null Het
Eif3e A T 15: 43,252,261 W370R probably damaging Het
Eya3 T A 4: 132,704,378 D323E probably damaging Het
F5 T C 1: 164,194,180 L1408P probably benign Het
Gfod1 C T 13: 43,200,516 G328S probably benign Het
Gja1 T A 10: 56,387,656 L37Q probably damaging Het
Gm10650 T A 3: 128,040,017 noncoding transcript Het
Gm14226 T A 2: 155,025,186 H354Q probably benign Het
Gm15056 T C 8: 20,900,742 T60A probably benign Het
Gm6614 T A 6: 142,008,688 M20L probably benign Het
Grrp1 T C 4: 134,251,730 T146A probably benign Het
Hsd11b1 A T 1: 193,242,245 N6K probably benign Het
Ighv1-36 T C 12: 114,880,122 I39M probably benign Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Kdm7a G A 6: 39,151,452 P482S possibly damaging Het
Lama5 C A 2: 180,198,786 E607* probably null Het
Lao1 T A 4: 118,967,476 S252T probably benign Het
Lrp12 A G 15: 39,878,254 F355S probably damaging Het
Mlycd T C 8: 119,410,304 F421S probably damaging Het
Nectin3 T C 16: 46,448,449 E530G probably benign Het
Nifk T C 1: 118,332,939 *270R probably null Het
Ocln T C 13: 100,539,598 Y129C probably damaging Het
Olfr1130 C T 2: 87,607,832 T148I probably benign Het
Olfr1278 T A 2: 111,292,487 L73H probably damaging Het
Olfr1472 A T 19: 13,453,985 C177* probably null Het
Olfr685 T A 7: 105,180,657 I219F possibly damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pcdhb22 G T 18: 37,519,126 G216C probably damaging Het
Ppcs T C 4: 119,419,215 K58E probably damaging Het
Prss38 T C 11: 59,374,370 T123A probably damaging Het
Rap1gap T A 4: 137,720,433 probably null Het
Rbm18 A G 2: 36,127,205 F54L possibly damaging Het
Rwdd3 G A 3: 121,159,783 probably benign Het
Ryr2 T C 13: 11,635,536 K138E possibly damaging Het
Sec24a T C 11: 51,713,532 probably null Het
Serpinb10 A G 1: 107,540,971 T115A probably benign Het
Slx4ip T G 2: 137,044,010 F83L probably damaging Het
St3gal1 A T 15: 67,108,229 S274T probably benign Het
Stab1 A C 14: 31,163,099 C121W probably damaging Het
Stab2 A G 10: 86,907,385 L1149P probably damaging Het
Svil T G 18: 5,048,954 I77R probably benign Het
Tbk1 T G 10: 121,576,336 E47A possibly damaging Het
Tert C T 13: 73,634,278 T557I probably damaging Het
Tfap2c A G 2: 172,552,027 D252G probably damaging Het
Tln2 T G 9: 67,354,468 N663T probably benign Het
Tmem245 T A 4: 56,946,945 Y156F possibly damaging Het
Uhrf1 G T 17: 56,320,542 probably null Het
Unc79 T A 12: 103,168,441 M2417K possibly damaging Het
Ush2a T C 1: 188,957,274 V5011A probably benign Het
Virma T C 4: 11,494,840 V47A possibly damaging Het
Vmn2r53 A C 7: 12,581,814 S693A probably benign Het
Vps54 G A 11: 21,319,881 probably benign Het
Znfx1 T C 2: 167,065,398 probably benign Het
Other mutations in Tll1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Tll1 APN 8 64016136 missense probably benign
IGL00583:Tll1 APN 8 64205292 missense probably benign
IGL00767:Tll1 APN 8 64071321 missense probably damaging 1.00
IGL01061:Tll1 APN 8 64038454 critical splice donor site probably null
IGL01077:Tll1 APN 8 64070232 missense probably benign 0.27
IGL01536:Tll1 APN 8 64074289 missense probably damaging 1.00
IGL02137:Tll1 APN 8 64016098 missense possibly damaging 0.73
IGL02168:Tll1 APN 8 64053967 missense possibly damaging 0.50
IGL02378:Tll1 APN 8 64017626 nonsense probably null
IGL02469:Tll1 APN 8 64070280 missense probably benign 0.41
IGL02504:Tll1 APN 8 64070237 missense possibly damaging 0.55
IGL02650:Tll1 APN 8 64046997 splice site probably benign
IGL02937:Tll1 APN 8 64205285 nonsense probably null
IGL03006:Tll1 APN 8 64074217 splice site probably benign
R0518:Tll1 UTSW 8 64098471 missense probably damaging 1.00
R0521:Tll1 UTSW 8 64098471 missense probably damaging 1.00
R0541:Tll1 UTSW 8 64038452 splice site probably null
R0612:Tll1 UTSW 8 64071310 missense possibly damaging 0.91
R0690:Tll1 UTSW 8 64074290 missense probably damaging 0.99
R0738:Tll1 UTSW 8 64101950 missense probably damaging 1.00
R1454:Tll1 UTSW 8 64038490 missense probably benign
R1619:Tll1 UTSW 8 64056273 missense probably benign 0.25
R1625:Tll1 UTSW 8 64041442 missense probably damaging 1.00
R1654:Tll1 UTSW 8 64117903 critical splice donor site probably null
R1663:Tll1 UTSW 8 64017686 missense probably benign 0.08
R1681:Tll1 UTSW 8 64085551 missense possibly damaging 0.93
R1713:Tll1 UTSW 8 64101873 missense probably damaging 0.99
R1908:Tll1 UTSW 8 64025107 missense probably damaging 0.98
R2118:Tll1 UTSW 8 64085557 missense probably benign 0.21
R2121:Tll1 UTSW 8 64085557 missense probably benign 0.21
R2124:Tll1 UTSW 8 64085557 missense probably benign 0.21
R2360:Tll1 UTSW 8 64051401 missense probably damaging 1.00
R2396:Tll1 UTSW 8 64070290 nonsense probably null
R3032:Tll1 UTSW 8 64098492 missense probably damaging 0.96
R3115:Tll1 UTSW 8 64053866 missense probably damaging 1.00
R3889:Tll1 UTSW 8 64205224 missense possibly damaging 0.77
R4126:Tll1 UTSW 8 64118014 missense possibly damaging 0.78
R4182:Tll1 UTSW 8 64041511 missense probably damaging 1.00
R4572:Tll1 UTSW 8 64056309 missense possibly damaging 0.81
R4677:Tll1 UTSW 8 64051377 missense probably benign 0.31
R4811:Tll1 UTSW 8 64085473 missense possibly damaging 0.72
R4904:Tll1 UTSW 8 64070199 missense probably benign 0.00
R4992:Tll1 UTSW 8 64093944 missense probably damaging 0.98
R5078:Tll1 UTSW 8 64093887 missense probably damaging 1.00
R5208:Tll1 UTSW 8 64051493 missense probably damaging 0.99
R5283:Tll1 UTSW 8 64101966 missense possibly damaging 0.68
R5399:Tll1 UTSW 8 64085488 missense probably damaging 1.00
R5699:Tll1 UTSW 8 64117940 missense probably damaging 0.98
R5986:Tll1 UTSW 8 64074263 missense probably damaging 0.99
R6019:Tll1 UTSW 8 64041491 missense possibly damaging 0.83
R6046:Tll1 UTSW 8 64053891 nonsense probably null
R6083:Tll1 UTSW 8 64038586 splice site probably null
R6125:Tll1 UTSW 8 64051487 missense probably damaging 1.00
R6222:Tll1 UTSW 8 64098534 missense probably benign 0.18
R6275:Tll1 UTSW 8 64051367 nonsense probably null
R6508:Tll1 UTSW 8 64098460 missense probably damaging 0.99
R6758:Tll1 UTSW 8 64041405 critical splice donor site probably null
R6782:Tll1 UTSW 8 64071281 missense probably benign 0.00
R6848:Tll1 UTSW 8 64098510 missense probably damaging 0.99
R7057:Tll1 UTSW 8 64101881 missense probably damaging 1.00
R7144:Tll1 UTSW 8 64124945 missense possibly damaging 0.90
R7244:Tll1 UTSW 8 64025188 missense probably benign 0.00
R7336:Tll1 UTSW 8 64025142 missense probably damaging 0.98
R7373:Tll1 UTSW 8 64051357 missense probably damaging 0.98
R7687:Tll1 UTSW 8 64121492 nonsense probably null
R7699:Tll1 UTSW 8 64093954 missense probably benign 0.00
R7700:Tll1 UTSW 8 64093954 missense probably benign 0.00
R7765:Tll1 UTSW 8 64051449 missense probably damaging 1.00
R7790:Tll1 UTSW 8 64025237 nonsense probably null
X0020:Tll1 UTSW 8 64017628 missense probably damaging 0.97
Z1176:Tll1 UTSW 8 64047163 missense not run
Predicted Primers PCR Primer
(F):5'- AGCCATGGTTGCTATGGAAG -3'
(R):5'- CCTTCCTATGTCACACAGTCAAG -3'

Sequencing Primer
(F):5'- CCATGGTTGCTATGGAAGAAAATAC -3'
(R):5'- TGTCACACAGTCAAGTATTAGAACC -3'
Posted On2016-06-06