Incidental Mutation 'R5061:Tbk1'
ID386628
Institutional Source Beutler Lab
Gene Symbol Tbk1
Ensembl Gene ENSMUSG00000020115
Gene NameTANK-binding kinase 1
Synonyms1200008B05Rik
MMRRC Submission 042651-MU
Accession Numbers

MGI: 1929658

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5061 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location121546455-121586787 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 121576336 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Alanine at position 47 (E47A)
Ref Sequence ENSEMBL: ENSMUSP00000151935 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020316] [ENSMUST00000219400] [ENSMUST00000219493]
Predicted Effect possibly damaging
Transcript: ENSMUST00000020316
AA Change: E99A

PolyPhen 2 Score 0.509 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000020316
Gene: ENSMUSG00000020115
AA Change: E99A

DomainStartEndE-ValueType
Pfam:Pkinase 9 300 2.6e-46 PFAM
Pfam:Pkinase_Tyr 10 250 1.5e-27 PFAM
low complexity region 355 366 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000219400
AA Change: E99A

PolyPhen 2 Score 0.407 (Sensitivity: 0.89; Specificity: 0.90)
Predicted Effect possibly damaging
Transcript: ENSMUST00000219493
AA Change: E47A

PolyPhen 2 Score 0.621 (Sensitivity: 0.87; Specificity: 0.91)
Meta Mutation Damage Score 0.2329 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.7%
Validation Efficiency 100% (71/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The NF-kappa-B (NFKB) complex of proteins is inhibited by I-kappa-B (IKB) proteins, which inactivate NFKB by trapping it in the cytoplasm. Phosphorylation of serine residues on the IKB proteins by IKB kinases marks them for destruction via the ubiquitination pathway, thereby allowing activation and nuclear translocation of the NFKB complex. The protein encoded by this gene is similar to IKB kinases and can mediate NFKB activation in response to certain growth factors. [provided by RefSeq, Oct 2010]
PHENOTYPE: Homozygous null mice display embryonic lethality. Mice homozygous for a different knock-out allele exhibit increased prenatal lethality, increased infiltration of mononuclear and/or granulomatous cells in multiple organs and tissues at 3 months of age, and increased lethality in response to LPS. [provided by MGI curators]
Allele List at MGI

All alleles(23) : Targeted(5) Gene trapped(18)

Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700009N14Rik A G 4: 39,450,953 H53R probably benign Het
Abcg1 A G 17: 31,092,392 K124E probably damaging Het
Acot4 G T 12: 84,038,701 R64L probably benign Het
Adam22 G C 5: 8,180,238 probably benign Het
Add2 G A 6: 86,087,047 probably null Het
Adgrb3 G A 1: 25,068,128 probably benign Het
Akap8l T G 17: 32,332,894 K441T probably damaging Het
Aspn T A 13: 49,566,604 S365R probably damaging Het
Atxn1 T G 13: 45,557,093 K788Q probably damaging Het
Atxn2l G T 7: 126,500,203 H135N probably damaging Het
Borcs8 T G 8: 70,140,358 probably null Het
Col5a1 G A 2: 27,952,378 D422N unknown Het
Cstad A T 2: 30,608,263 T37S unknown Het
Dgkq A T 5: 108,654,123 D455E probably benign Het
Dopey1 T C 9: 86,503,108 probably benign Het
Ebf3 T C 7: 137,313,559 I84V possibly damaging Het
Ehmt2 C T 17: 34,899,091 R40* probably null Het
Eif3e A T 15: 43,252,261 W370R probably damaging Het
Eya3 T A 4: 132,704,378 D323E probably damaging Het
F5 T C 1: 164,194,180 L1408P probably benign Het
Gfod1 C T 13: 43,200,516 G328S probably benign Het
Gja1 T A 10: 56,387,656 L37Q probably damaging Het
Gm10650 T A 3: 128,040,017 noncoding transcript Het
Gm14226 T A 2: 155,025,186 H354Q probably benign Het
Gm15056 T C 8: 20,900,742 T60A probably benign Het
Gm6614 T A 6: 142,008,688 M20L probably benign Het
Grrp1 T C 4: 134,251,730 T146A probably benign Het
Hsd11b1 A T 1: 193,242,245 N6K probably benign Het
Ighv1-36 T C 12: 114,880,122 I39M probably benign Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Kdm7a G A 6: 39,151,452 P482S possibly damaging Het
Lama5 C A 2: 180,198,786 E607* probably null Het
Lao1 T A 4: 118,967,476 S252T probably benign Het
Lrp12 A G 15: 39,878,254 F355S probably damaging Het
Mlycd T C 8: 119,410,304 F421S probably damaging Het
Nectin3 T C 16: 46,448,449 E530G probably benign Het
Nifk T C 1: 118,332,939 *270R probably null Het
Ocln T C 13: 100,539,598 Y129C probably damaging Het
Olfr1130 C T 2: 87,607,832 T148I probably benign Het
Olfr1278 T A 2: 111,292,487 L73H probably damaging Het
Olfr1472 A T 19: 13,453,985 C177* probably null Het
Olfr685 T A 7: 105,180,657 I219F possibly damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pcdhb22 G T 18: 37,519,126 G216C probably damaging Het
Ppcs T C 4: 119,419,215 K58E probably damaging Het
Prss38 T C 11: 59,374,370 T123A probably damaging Het
Rap1gap T A 4: 137,720,433 probably null Het
Rbm18 A G 2: 36,127,205 F54L possibly damaging Het
Rwdd3 G A 3: 121,159,783 probably benign Het
Ryr2 T C 13: 11,635,536 K138E possibly damaging Het
Sec24a T C 11: 51,713,532 probably null Het
Serpinb10 A G 1: 107,540,971 T115A probably benign Het
Slx4ip T G 2: 137,044,010 F83L probably damaging Het
St3gal1 A T 15: 67,108,229 S274T probably benign Het
Stab1 A C 14: 31,163,099 C121W probably damaging Het
Stab2 A G 10: 86,907,385 L1149P probably damaging Het
Svil T G 18: 5,048,954 I77R probably benign Het
Tert C T 13: 73,634,278 T557I probably damaging Het
Tfap2c A G 2: 172,552,027 D252G probably damaging Het
Tll1 C A 8: 64,053,949 C586F probably damaging Het
Tln2 T G 9: 67,354,468 N663T probably benign Het
Tmem245 T A 4: 56,946,945 Y156F possibly damaging Het
Uhrf1 G T 17: 56,320,542 probably null Het
Unc79 T A 12: 103,168,441 M2417K possibly damaging Het
Ush2a T C 1: 188,957,274 V5011A probably benign Het
Virma T C 4: 11,494,840 V47A possibly damaging Het
Vmn2r53 A C 7: 12,581,814 S693A probably benign Het
Vps54 G A 11: 21,319,881 probably benign Het
Znfx1 T C 2: 167,065,398 probably benign Het
Other mutations in Tbk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00514:Tbk1 APN 10 121552250 missense probably benign 0.00
IGL01021:Tbk1 APN 10 121551272 missense probably benign 0.07
IGL01371:Tbk1 APN 10 121559871 missense probably benign 0.09
IGL01383:Tbk1 APN 10 121576279 missense probably damaging 1.00
IGL01583:Tbk1 APN 10 121557229 missense probably benign
IGL01734:Tbk1 APN 10 121571983 nonsense probably null
IGL02068:Tbk1 APN 10 121570789 missense probably damaging 1.00
IGL02676:Tbk1 APN 10 121568080 missense possibly damaging 0.82
IGL02737:Tbk1 APN 10 121559862 missense probably null 0.96
IGL03334:Tbk1 APN 10 121584199 missense possibly damaging 0.79
pioneer UTSW 10 121578690 missense probably damaging 1.00
trailblazer UTSW 10 121570685 missense probably damaging 1.00
R0030:Tbk1 UTSW 10 121561624 missense probably benign 0.09
R0386:Tbk1 UTSW 10 121584254 missense probably damaging 0.96
R1396:Tbk1 UTSW 10 121571916 missense probably damaging 1.00
R1430:Tbk1 UTSW 10 121559934 missense probably benign
R1522:Tbk1 UTSW 10 121551318 missense probably benign 0.06
R1542:Tbk1 UTSW 10 121559935 missense probably benign
R1717:Tbk1 UTSW 10 121561645 missense probably benign 0.10
R1860:Tbk1 UTSW 10 121547171 missense probably benign 0.01
R2188:Tbk1 UTSW 10 121563931 nonsense probably null
R2519:Tbk1 UTSW 10 121557259 missense probably benign 0.03
R4627:Tbk1 UTSW 10 121568080 missense possibly damaging 0.82
R4945:Tbk1 UTSW 10 121551269 missense probably damaging 0.98
R5256:Tbk1 UTSW 10 121570685 missense probably damaging 1.00
R5310:Tbk1 UTSW 10 121556051 missense probably benign 0.00
R6187:Tbk1 UTSW 10 121584243 missense probably benign 0.02
R6425:Tbk1 UTSW 10 121563962 missense probably benign 0.00
R6512:Tbk1 UTSW 10 121578621 missense probably damaging 1.00
R6897:Tbk1 UTSW 10 121559877 missense probably benign 0.00
R7268:Tbk1 UTSW 10 121552499 missense probably benign 0.03
R7609:Tbk1 UTSW 10 121552501 missense probably damaging 0.98
R7860:Tbk1 UTSW 10 121552246 missense possibly damaging 0.55
R7943:Tbk1 UTSW 10 121552246 missense possibly damaging 0.55
X0022:Tbk1 UTSW 10 121560293 missense probably benign
Predicted Primers PCR Primer
(F):5'- CTTCCTGTTAGGCACTGTGC -3'
(R):5'- GACAGTTCACGGTGACTGTCAC -3'

Sequencing Primer
(F):5'- CTGTTAGGCACTGTGCTTTTAC -3'
(R):5'- TGACTGTCACTGCAGCGTG -3'
Posted On2016-06-06