Mutagenetix > Incidental Mutations

Incidental Mutation 'R5061:Svil'

386653

Institutional Source

Beutler Lab

Gene Symbol

Svil

Ensembl Gene

ENSMUSG00000024236

Gene Name

supervillin

Synonyms

B430302E16Rik

MMRRC Submission

042651-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.159) question?

Stock #

R5061 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

4920540-5119299 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 5048954 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Arginine at position 77 (I77R)

Ref Sequence

ENSEMBL: ENSMUSP00000122242 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000025079] [ENSMUST00000126977] [ENSMUST00000127297] [ENSMUST00000131609] [ENSMUST00000140448] [ENSMUST00000143254] [ENSMUST00000153016] [ENSMUST00000210707]

Predicted Effect

probably benign
Transcript: ENSMUST00000025079
AA Change: I77R

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)

SMART Domains

Protein: ENSMUSP00000025079
Gene: ENSMUSG00000024236
AA Change: I77R

Domain	Start	End	E-Value	Type
low complexity region	1181	1191	N/A	INTRINSIC
GEL	1397	1496	4.58e-22	SMART
GEL	1521	1638	4.03e-1	SMART
GEL	1708	1818	2.93e-20	SMART
low complexity region	1825	1831	N/A	INTRINSIC
GEL	1837	1938	1.72e-17	SMART
GEL	1971	2078	1.37e0	SMART
VHP	2135	2170	1.15e-18	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000126977
AA Change: I77R

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)

SMART Domains

Protein: ENSMUSP00000115078
Gene: ENSMUSG00000024236
AA Change: I77R

Domain	Start	End	E-Value	Type
low complexity region	1181	1191	N/A	INTRINSIC
GEL	1397	1496	4.58e-22	SMART
GEL	1521	1638	4.03e-1	SMART
GEL	1708	1818	2.93e-20	SMART
low complexity region	1825	1831	N/A	INTRINSIC
GEL	1837	1938	1.72e-17	SMART
GEL	1971	2078	1.37e0	SMART
VHP	2135	2170	1.15e-18	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000127297
AA Change: I77R

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)

SMART Domains

Protein: ENSMUSP00000115223
Gene: ENSMUSG00000024236
AA Change: I77R

Domain	Start	End	E-Value	Type
low complexity region	1067	1077	N/A	INTRINSIC
GEL	1283	1382	4.58e-22	SMART
GEL	1407	1524	4.03e-1	SMART
GEL	1594	1704	2.93e-20	SMART
low complexity region	1711	1717	N/A	INTRINSIC
GEL	1723	1824	1.72e-17	SMART
GEL	1857	1964	1.37e0	SMART
VHP	2021	2056	1.15e-18	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000131210

Predicted Effect

probably benign
Transcript: ENSMUST00000131609
AA Change: I77R

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000122242
Gene: ENSMUSG00000024236
AA Change: I77R

Domain	Start	End	E-Value	Type
low complexity region	1181	1191	N/A	INTRINSIC
GEL	1397	1496	2.9e-24	SMART
GEL	1521	1638	2.5e-3	SMART
GEL	1708	1818	1.9e-22	SMART
low complexity region	1825	1831	N/A	INTRINSIC
GEL	1837	1938	1.1e-19	SMART
low complexity region	1965	1974	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000138258

Predicted Effect

probably benign
Transcript: ENSMUST00000140448
AA Change: I77R

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)

SMART Domains

Protein: ENSMUSP00000119803
Gene: ENSMUSG00000024236
AA Change: I77R

Domain	Start	End	E-Value	Type
low complexity region	1181	1191	N/A	INTRINSIC
GEL	1397	1496	4.58e-22	SMART
GEL	1521	1638	4.03e-1	SMART
GEL	1708	1818	2.93e-20	SMART
low complexity region	1825	1831	N/A	INTRINSIC
GEL	1837	1938	1.72e-17	SMART
GEL	1971	2078	1.37e0	SMART
VHP	2135	2170	1.15e-18	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000143254
AA Change: I77R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000119287
Gene: ENSMUSG00000024236
AA Change: I77R

Domain	Start	End	E-Value	Type
low complexity region	777	787	N/A	INTRINSIC
GEL	993	1092	4.58e-22	SMART
GEL	1117	1234	4.03e-1	SMART
GEL	1304	1414	2.93e-20	SMART
low complexity region	1421	1427	N/A	INTRINSIC
GEL	1433	1534	1.72e-17	SMART
GEL	1567	1674	1.37e0	SMART
VHP	1731	1766	1.15e-18	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000153016

Predicted Effect

probably benign
Transcript: ENSMUST00000210707
AA Change: I164R

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.8%
20x: 93.7%

Validation Efficiency

100% (71/71)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a bipartite protein with distinct amino- and carboxy-terminal domains. The amino-terminus contains nuclear localization signals and the carboxy-terminus contains numerous consecutive sequences with extensive similarity to proteins in the gelsolin family of actin-binding proteins, which cap, nucleate, and/or sever actin filaments. The gene product is tightly associated with both actin filaments and plasma membranes, suggesting a role as a high-affinity link between the actin cytoskeleton and the membrane. The encoded protein appears to aid in both myosin II assembly during cell spreading and disassembly of focal adhesions. Several transcript variants encoding different isoforms of supervillin have been described. [provided by RefSeq, Apr 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit enhanched adhesion and thrombus formation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 69 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700009N14Rik	A	G	4: 39,450,953	H53R	probably benign	Het
Abcg1	A	G	17: 31,092,392	K124E	probably damaging	Het
Acot4	G	T	12: 84,038,701	R64L	probably benign	Het
Adam22	G	C	5: 8,180,238		probably benign	Het
Add2	G	A	6: 86,087,047		probably null	Het
Adgrb3	G	A	1: 25,068,128		probably benign	Het
Akap8l	T	G	17: 32,332,894	K441T	probably damaging	Het
Aspn	T	A	13: 49,566,604	S365R	probably damaging	Het
Atxn1	T	G	13: 45,557,093	K788Q	probably damaging	Het
Atxn2l	G	T	7: 126,500,203	H135N	probably damaging	Het
Borcs8	T	G	8: 70,140,358		probably null	Het
Col5a1	G	A	2: 27,952,378	D422N	unknown	Het
Cstad	A	T	2: 30,608,263	T37S	unknown	Het
Dgkq	A	T	5: 108,654,123	D455E	probably benign	Het
Dopey1	T	C	9: 86,503,108		probably benign	Het
Ebf3	T	C	7: 137,313,559	I84V	possibly damaging	Het
Ehmt2	C	T	17: 34,899,091	R40*	probably null	Het
Eif3e	A	T	15: 43,252,261	W370R	probably damaging	Het
Eya3	T	A	4: 132,704,378	D323E	probably damaging	Het
F5	T	C	1: 164,194,180	L1408P	probably benign	Het
Gfod1	C	T	13: 43,200,516	G328S	probably benign	Het
Gja1	T	A	10: 56,387,656	L37Q	probably damaging	Het
Gm10650	T	A	3: 128,040,017		noncoding transcript	Het
Gm14226	T	A	2: 155,025,186	H354Q	probably benign	Het
Gm15056	T	C	8: 20,900,742	T60A	probably benign	Het
Gm6614	T	A	6: 142,008,688	M20L	probably benign	Het
Grrp1	T	C	4: 134,251,730	T146A	probably benign	Het
Hsd11b1	A	T	1: 193,242,245	N6K	probably benign	Het
Ighv1-36	T	C	12: 114,880,122	I39M	probably benign	Het
Igkv4-80	A	C	6: 69,016,665	S81A	probably benign	Het
Kdm7a	G	A	6: 39,151,452	P482S	possibly damaging	Het
Lama5	C	A	2: 180,198,786	E607*	probably null	Het
Lao1	T	A	4: 118,967,476	S252T	probably benign	Het
Lrp12	A	G	15: 39,878,254	F355S	probably damaging	Het
Mlycd	T	C	8: 119,410,304	F421S	probably damaging	Het
Nectin3	T	C	16: 46,448,449	E530G	probably benign	Het
Nifk	T	C	1: 118,332,939	*270R	probably null	Het
Ocln	T	C	13: 100,539,598	Y129C	probably damaging	Het
Olfr1130	C	T	2: 87,607,832	T148I	probably benign	Het
Olfr1278	T	A	2: 111,292,487	L73H	probably damaging	Het
Olfr1472	A	T	19: 13,453,985	C177*	probably null	Het
Olfr685	T	A	7: 105,180,657	I219F	possibly damaging	Het
Otx1	C	A	11: 21,997,037	A91S	probably damaging	Het
Pcdhb22	G	T	18: 37,519,126	G216C	probably damaging	Het
Ppcs	T	C	4: 119,419,215	K58E	probably damaging	Het
Prss38	T	C	11: 59,374,370	T123A	probably damaging	Het
Rap1gap	T	A	4: 137,720,433		probably null	Het
Rbm18	A	G	2: 36,127,205	F54L	possibly damaging	Het
Rwdd3	G	A	3: 121,159,783		probably benign	Het
Ryr2	T	C	13: 11,635,536	K138E	possibly damaging	Het
Sec24a	T	C	11: 51,713,532		probably null	Het
Serpinb10	A	G	1: 107,540,971	T115A	probably benign	Het
Slx4ip	T	G	2: 137,044,010	F83L	probably damaging	Het
St3gal1	A	T	15: 67,108,229	S274T	probably benign	Het
Stab1	A	C	14: 31,163,099	C121W	probably damaging	Het
Stab2	A	G	10: 86,907,385	L1149P	probably damaging	Het
Tbk1	T	G	10: 121,576,336	E47A	possibly damaging	Het
Tert	C	T	13: 73,634,278	T557I	probably damaging	Het
Tfap2c	A	G	2: 172,552,027	D252G	probably damaging	Het
Tll1	C	A	8: 64,053,949	C586F	probably damaging	Het
Tln2	T	G	9: 67,354,468	N663T	probably benign	Het
Tmem245	T	A	4: 56,946,945	Y156F	possibly damaging	Het
Uhrf1	G	T	17: 56,320,542		probably null	Het
Unc79	T	A	12: 103,168,441	M2417K	possibly damaging	Het
Ush2a	T	C	1: 188,957,274	V5011A	probably benign	Het
Virma	T	C	4: 11,494,840	V47A	possibly damaging	Het
Vmn2r53	A	C	7: 12,581,814	S693A	probably benign	Het
Vps54	G	A	11: 21,319,881		probably benign	Het
Znfx1	T	C	2: 167,065,398		probably benign	Het

Other mutations in Svil

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00226:Svil	APN	18	5099045	missense	probably benign	0.27
IGL00840:Svil	APN	18	5063555	missense	probably benign
IGL01329:Svil	APN	18	5064501	missense	probably benign
IGL01446:Svil	APN	18	5062385	missense	probably damaging	1.00
IGL02068:Svil	APN	18	5092899	missense	probably damaging	1.00
IGL02223:Svil	APN	18	5105879	splice site	probably benign
IGL02428:Svil	APN	18	5118203	missense	probably damaging	1.00
IGL02429:Svil	APN	18	5118369	missense	probably benign	0.00
IGL02479:Svil	APN	18	5099476	missense	probably damaging	1.00
IGL02560:Svil	APN	18	5049379	missense	probably benign	0.00
IGL02652:Svil	APN	18	5114531	missense	probably damaging	1.00
IGL03291:Svil	APN	18	5056150	nonsense	probably null
BB002:Svil	UTSW	18	5118357	missense	probably benign	0.00
BB012:Svil	UTSW	18	5118357	missense	probably benign	0.00
IGL03055:Svil	UTSW	18	5108615	missense	probably damaging	1.00
R0029:Svil	UTSW	18	5063286	missense	probably benign	0.14
R0029:Svil	UTSW	18	5063286	missense	probably benign	0.14
R0266:Svil	UTSW	18	5099063	splice site	probably benign
R0281:Svil	UTSW	18	5094582	missense	probably damaging	1.00
R0442:Svil	UTSW	18	5046870	missense	probably damaging	1.00
R0549:Svil	UTSW	18	5064566	missense	possibly damaging	0.79
R0617:Svil	UTSW	18	5117002	missense	probably damaging	1.00
R0801:Svil	UTSW	18	5099443	missense	probably benign	0.00
R0894:Svil	UTSW	18	5097494	missense	probably damaging	1.00
R1053:Svil	UTSW	18	5056690	missense	probably benign	0.16
R1065:Svil	UTSW	18	5063777	splice site	probably benign
R1080:Svil	UTSW	18	5058147	missense	possibly damaging	0.79
R1199:Svil	UTSW	18	5059217	splice site	probably benign
R1472:Svil	UTSW	18	5048950	missense	probably benign	0.09
R1480:Svil	UTSW	18	5057345	missense	probably damaging	1.00
R1544:Svil	UTSW	18	5046817	missense	possibly damaging	0.93
R1626:Svil	UTSW	18	5117099	critical splice donor site	probably null
R1691:Svil	UTSW	18	5056336	missense	probably benign	0.06
R1812:Svil	UTSW	18	5097545	missense	probably damaging	1.00
R1826:Svil	UTSW	18	5063383	missense	probably benign	0.01
R1842:Svil	UTSW	18	5062373	missense	probably damaging	1.00
R1884:Svil	UTSW	18	5094640	missense	possibly damaging	0.94
R1945:Svil	UTSW	18	5117059	missense	probably damaging	1.00
R2184:Svil	UTSW	18	5099534	missense	probably damaging	1.00
R2184:Svil	UTSW	18	5099615	missense	probably damaging	1.00
R2232:Svil	UTSW	18	5046640	start codon destroyed	probably null	0.98
R2398:Svil	UTSW	18	5060613	splice site	probably null
R3076:Svil	UTSW	18	5116055	missense	probably damaging	1.00
R3777:Svil	UTSW	18	5090855	missense	probably damaging	0.97
R3779:Svil	UTSW	18	5090855	missense	probably damaging	0.97
R3797:Svil	UTSW	18	5060534	missense	probably benign	0.29
R4077:Svil	UTSW	18	5063522	missense	probably benign	0.03
R4350:Svil	UTSW	18	5118154	missense	probably damaging	1.00
R4379:Svil	UTSW	18	5046909	missense	probably damaging	1.00
R4488:Svil	UTSW	18	5049067	missense	probably damaging	1.00
R4777:Svil	UTSW	18	5088813	missense	probably damaging	0.99
R4825:Svil	UTSW	18	5114564	missense	probably damaging	1.00
R4921:Svil	UTSW	18	5108631	missense	probably damaging	1.00
R4969:Svil	UTSW	18	5095516	missense	probably damaging	1.00
R4975:Svil	UTSW	18	5054025	missense	possibly damaging	0.61
R4990:Svil	UTSW	18	5056810	missense	probably benign	0.05
R4991:Svil	UTSW	18	5056810	missense	probably benign	0.05
R5271:Svil	UTSW	18	5062329	missense	probably benign	0.45
R5362:Svil	UTSW	18	5057345	missense	probably damaging	1.00
R5433:Svil	UTSW	18	5059294	missense	probably damaging	0.99
R5677:Svil	UTSW	18	5046823	nonsense	probably null
R5850:Svil	UTSW	18	5098900	splice site	probably null
R5868:Svil	UTSW	18	5056854	splice site	probably null
R5871:Svil	UTSW	18	5103669	splice site	probably null
R5876:Svil	UTSW	18	5082828	missense	probably damaging	1.00
R6061:Svil	UTSW	18	5106724	missense	probably damaging	1.00
R6062:Svil	UTSW	18	5106724	missense	probably damaging	1.00
R6063:Svil	UTSW	18	5106724	missense	probably damaging	1.00
R6065:Svil	UTSW	18	5106724	missense	probably damaging	1.00
R6066:Svil	UTSW	18	5106724	missense	probably damaging	1.00
R6114:Svil	UTSW	18	5108639	missense	probably damaging	1.00
R6115:Svil	UTSW	18	5108675	missense	probably damaging	0.99
R6117:Svil	UTSW	18	5116016	missense	probably damaging	1.00
R6302:Svil	UTSW	18	5057432	missense	probably benign	0.13
R6418:Svil	UTSW	18	5040171	missense	probably benign	0.26
R6441:Svil	UTSW	18	5049323	missense	probably benign
R6446:Svil	UTSW	18	5057323	missense	probably benign	0.09
R6455:Svil	UTSW	18	5056629	missense	possibly damaging	0.89
R6545:Svil	UTSW	18	5108621	missense	probably benign	0.00
R6692:Svil	UTSW	18	5082853	missense	probably damaging	1.00
R6730:Svil	UTSW	18	5049311	missense	probably benign	0.17
R6763:Svil	UTSW	18	5056437	missense	probably damaging	0.99
R6870:Svil	UTSW	18	5063231	missense	possibly damaging	0.86
R6916:Svil	UTSW	18	5114682	utr 3 prime	probably benign
R7134:Svil	UTSW	18	5116080	missense	probably damaging	1.00
R7190:Svil	UTSW	18	5092937	missense	probably benign	0.01
R7213:Svil	UTSW	18	5094574	missense	probably damaging	0.99
R7249:Svil	UTSW	18	5056270	missense	probably benign	0.01
R7249:Svil	UTSW	18	5062247	missense	probably damaging	0.99
R7421:Svil	UTSW	18	5056109	missense	probably benign	0.18
R7571:Svil	UTSW	18	5114636	missense	probably damaging	1.00
R7574:Svil	UTSW	18	5095188	missense	probably benign	0.16
R7645:Svil	UTSW	18	5099663	missense	probably damaging	1.00
R7925:Svil	UTSW	18	5118357	missense	probably benign	0.00
R8113:Svil	UTSW	18	5062385	missense	probably damaging	1.00
R8263:Svil	UTSW	18	5108679	missense	probably damaging	1.00
R8485:Svil	UTSW	18	5064566	missense	probably benign	0.03
R8491:Svil	UTSW	18	5106678	missense	probably damaging	1.00
X0065:Svil	UTSW	18	5062317	missense	probably damaging	1.00
Z1177:Svil	UTSW	18	5062344	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGGCAGATGACAGCCTAGTTAC -3'
(R):5'- CTCTCAGTCACATCTGGGTC -3'

Sequencing Primer
(F):5'- ATGACAGCCTAGTTACTGGGGC -3'
(R):5'- CCTTCCGAGACTTGGCATATCGAG -3'

Posted On

2016-06-06