Incidental Mutation 'R5062:Phgdh'
ID 386667
Institutional Source Beutler Lab
Gene Symbol Phgdh
Ensembl Gene ENSMUSG00000053398
Gene Name 3-phosphoglycerate dehydrogenase
Synonyms PGD, 3-PGDH, A10, PGAD, PGDH, SERA, 3PGDH
MMRRC Submission 042652-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R5062 (G1)
Quality Score 152
Status Validated
Chromosome 3
Chromosomal Location 98313170-98339990 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 98328339 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 121 (I121F)
Ref Sequence ENSEMBL: ENSMUSP00000064755 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065793]
AlphaFold Q61753
Predicted Effect probably damaging
Transcript: ENSMUST00000065793
AA Change: I121F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000064755
Gene: ENSMUSG00000053398
AA Change: I121F

DomainStartEndE-ValueType
Pfam:2-Hacid_dh 9 317 2.1e-42 PFAM
Pfam:2-Hacid_dh_C 111 285 3.5e-60 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000148488
AA Change: I92F
SMART Domains Protein: ENSMUSP00000117525
Gene: ENSMUSG00000053398
AA Change: I92F

DomainStartEndE-ValueType
Pfam:2-Hacid_dh 7 145 1.1e-27 PFAM
Pfam:2-Hacid_dh_C 83 149 1.3e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152106
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153694
Meta Mutation Damage Score 0.8279 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.7%
  • 20x: 90.1%
Validation Efficiency 100% (79/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the enzyme which is involved in the early steps of L-serine synthesis in animal cells. L-serine is required for D-serine and other amino acid synthesis. The enzyme requires NAD/NADH as a cofactor and forms homotetramers for activity. Mutations in this gene have been found in a family with congenital microcephaly, psychomotor retardation and other symptoms. Multiple alternatively spliced transcript variants have been found, however the full-length nature of most are not known. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for a null allele die by E13.5 and exhibit abnormal neural development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 A T 11: 110,177,066 I1593N probably benign Het
Akr1b10 G T 6: 34,392,106 K173N probably damaging Het
Artn A T 4: 117,927,676 L3Q probably damaging Het
Asxl3 T A 18: 22,522,718 S1262T possibly damaging Het
Atp6v0a4 A T 6: 38,074,183 M420K probably benign Het
Bcam T A 7: 19,760,101 T422S possibly damaging Het
Casp2 C T 6: 42,269,272 probably benign Het
Ccdc137 A G 11: 120,462,515 probably benign Het
Cd177 C A 7: 24,744,316 A786S probably benign Het
Cdca4 T C 12: 112,821,863 N82D probably benign Het
Clu A C 14: 65,979,728 T337P probably damaging Het
Col6a3 A C 1: 90,779,352 I2013S unknown Het
Cpne9 T A 6: 113,304,488 M510K probably damaging Het
Cyp3a13 A C 5: 137,898,899 N384K possibly damaging Het
Fam186a A C 15: 99,944,646 I1239S possibly damaging Het
Fryl T C 5: 73,075,893 E413G possibly damaging Het
Fscn2 A C 11: 120,366,749 Y312S probably damaging Het
Fshr A T 17: 88,986,046 C401* probably null Het
Glyat A C 19: 12,650,263 Q74P probably damaging Het
Gm5724 A C 6: 141,767,454 M67R possibly damaging Het
Gm6158 A T 14: 24,070,090 noncoding transcript Het
Grm7 A G 6: 110,646,136 N90S probably damaging Het
Hectd1 A T 12: 51,744,879 C2536S probably damaging Het
Herc3 C T 6: 58,855,760 Q137* probably null Het
Kctd3 A C 1: 188,995,693 probably benign Het
Klhl30 A G 1: 91,355,578 T301A probably benign Het
Klra9 T C 6: 130,179,109 K228E possibly damaging Het
Lamc3 A T 2: 31,905,667 T355S possibly damaging Het
Lcmt1 A C 7: 123,410,830 probably null Het
Limch1 C T 5: 66,969,235 P60S probably damaging Het
Lrfn2 A G 17: 49,070,500 D203G probably damaging Het
Mc5r T C 18: 68,339,281 L237P probably damaging Het
Mknk2 G A 10: 80,671,769 R58W probably damaging Het
Mrgpra2b T C 7: 47,502,928 probably benign Het
Mroh2a GCCC GC 1: 88,232,257 probably null Het
Nae1 A T 8: 104,516,702 C395S possibly damaging Het
Ncoa1 A G 12: 4,259,333 M1321T probably damaging Het
Neb A C 2: 52,280,501 F1720V possibly damaging Het
Nectin2 C T 7: 19,738,273 V64I probably benign Het
Nisch T A 14: 31,172,440 T1145S probably damaging Het
Nlrp5 A T 7: 23,435,910 R1009* probably null Het
Olfr103 A T 17: 37,336,931 H100Q probably damaging Het
Olfr727 T A 14: 50,127,437 Y287N probably damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pak1ip1 A G 13: 41,008,145 probably benign Het
Pcm1 T C 8: 41,259,260 V189A probably damaging Het
Peak1 G T 9: 56,260,289 N118K probably damaging Het
Pi4ka G T 16: 17,309,397 A1064E probably benign Het
Pkhd1 A C 1: 20,585,711 C199W probably benign Het
Plat A G 8: 22,772,311 D117G probably benign Het
Ppp2r2b C A 18: 42,688,461 V211L possibly damaging Het
Ptgs1 A G 2: 36,237,282 D60G probably damaging Het
Ryr2 T C 13: 11,700,354 E2776G probably damaging Het
Sema4c C T 1: 36,552,978 probably null Het
Sharpin T C 15: 76,347,611 probably benign Het
Slamf6 A G 1: 171,936,533 I164M possibly damaging Het
Spef1 A G 2: 131,173,281 Y46H probably damaging Het
Spns1 G A 7: 126,374,329 probably benign Het
Supt5 C T 7: 28,329,015 probably null Het
Tbx5 T A 5: 119,836,922 D3E probably damaging Het
Thbs1 T C 2: 118,121,237 probably null Het
Tmem140 G A 6: 34,872,962 V138M probably damaging Het
Tmem200a T A 10: 25,993,915 D152V probably damaging Het
Tmem200b A G 4: 131,922,537 D256G probably damaging Het
Tns1 A T 1: 73,952,864 L885Q probably damaging Het
Umod G A 7: 119,472,421 Q366* probably null Het
Vsir A G 10: 60,364,263 I208V probably damaging Het
Zfp646 G A 7: 127,880,499 R616H probably damaging Het
Other mutations in Phgdh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00429:Phgdh APN 3 98328315 missense probably damaging 1.00
R0195:Phgdh UTSW 3 98316550 unclassified probably benign
R0636:Phgdh UTSW 3 98333291 missense possibly damaging 0.89
R0787:Phgdh UTSW 3 98334549 missense probably damaging 1.00
R1626:Phgdh UTSW 3 98316409 missense probably benign 0.16
R1733:Phgdh UTSW 3 98328135 missense probably benign 0.00
R1782:Phgdh UTSW 3 98320747 missense probably damaging 0.97
R2173:Phgdh UTSW 3 98315111 missense probably benign 0.00
R2256:Phgdh UTSW 3 98328291 missense probably benign 0.30
R2367:Phgdh UTSW 3 98314296 missense probably benign 0.07
R2495:Phgdh UTSW 3 98339789 missense probably damaging 1.00
R4214:Phgdh UTSW 3 98328061 missense possibly damaging 0.79
R4410:Phgdh UTSW 3 98314275 missense probably benign
R5378:Phgdh UTSW 3 98321323 splice site probably null
R5528:Phgdh UTSW 3 98328339 missense probably benign 0.13
R7357:Phgdh UTSW 3 98339822 missense probably benign 0.00
R7436:Phgdh UTSW 3 98339729 missense probably benign 0.34
R7894:Phgdh UTSW 3 98339808 missense probably damaging 0.98
R8373:Phgdh UTSW 3 98321245 missense probably damaging 1.00
R8467:Phgdh UTSW 3 98321311 missense probably benign
R8762:Phgdh UTSW 3 98339708 missense possibly damaging 0.51
R9547:Phgdh UTSW 3 98334634 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAACTGCAACCAGAAAGGC -3'
(R):5'- CCCAAGTCATGTCCTACCAATG -3'

Sequencing Primer
(F):5'- CAAAAGGCAAAGATGACCAAGTC -3'
(R):5'- AAGTCATGTCCTACCAATGTTCTCAC -3'
Posted On 2016-06-06