Incidental Mutation 'R5062:Tmem200b'
ID386669
Institutional Source Beutler Lab
Gene Symbol Tmem200b
Ensembl Gene ENSMUSG00000070720
Gene Nametransmembrane protein 200B
SynonymsEG623230
MMRRC Submission 042652-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.360) question?
Stock #R5062 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location131921771-131923140 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 131922537 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 256 (D256G)
Ref Sequence ENSEMBL: ENSMUSP00000092253 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030739] [ENSMUST00000054917] [ENSMUST00000084253] [ENSMUST00000094666] [ENSMUST00000105970] [ENSMUST00000105972] [ENSMUST00000105974] [ENSMUST00000105975] [ENSMUST00000105981] [ENSMUST00000137846]
Predicted Effect probably benign
Transcript: ENSMUST00000030739
SMART Domains Protein: ENSMUSP00000030739
Gene: ENSMUSG00000028906

DomainStartEndE-ValueType
low complexity region 31 53 N/A INTRINSIC
low complexity region 74 94 N/A INTRINSIC
low complexity region 98 121 N/A INTRINSIC
B41 207 402 1.3e-80 SMART
FERM_C 406 496 1.01e-35 SMART
FA 499 545 8.99e-19 SMART
low complexity region 594 607 N/A INTRINSIC
Pfam:SAB 661 709 1.8e-29 PFAM
Pfam:4_1_CTD 741 855 3.5e-57 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000054917
SMART Domains Protein: ENSMUSP00000060375
Gene: ENSMUSG00000028906

DomainStartEndE-ValueType
low complexity region 31 53 N/A INTRINSIC
low complexity region 74 94 N/A INTRINSIC
low complexity region 98 121 N/A INTRINSIC
B41 207 402 1.3e-80 SMART
FERM_C 406 496 1.01e-35 SMART
FA 499 545 8.99e-19 SMART
Pfam:SAB 607 655 2.3e-28 PFAM
Pfam:4_1_CTD 687 801 3.2e-57 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000084253
SMART Domains Protein: ENSMUSP00000081274
Gene: ENSMUSG00000028906

DomainStartEndE-ValueType
low complexity region 31 53 N/A INTRINSIC
low complexity region 74 94 N/A INTRINSIC
low complexity region 98 121 N/A INTRINSIC
B41 207 402 1.3e-80 SMART
FERM_C 406 496 1.01e-35 SMART
FA 499 545 8.99e-19 SMART
Pfam:SAB 607 655 2.3e-28 PFAM
Pfam:4_1_CTD 687 801 3.2e-57 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000094666
AA Change: D256G

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000092253
Gene: ENSMUSG00000070720
AA Change: D256G

DomainStartEndE-ValueType
Pfam:DUF2371 14 92 8.8e-13 PFAM
Pfam:DUF2371 86 131 7.6e-17 PFAM
low complexity region 172 187 N/A INTRINSIC
low complexity region 204 216 N/A INTRINSIC
low complexity region 240 250 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105970
SMART Domains Protein: ENSMUSP00000101590
Gene: ENSMUSG00000028906

DomainStartEndE-ValueType
B41 55 250 1.3e-80 SMART
FERM_C 254 344 1.01e-35 SMART
FA 347 393 8.99e-19 SMART
low complexity region 437 459 N/A INTRINSIC
Pfam:SAB 476 524 1.1e-29 PFAM
Pfam:4_1_CTD 578 636 1.4e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105972
SMART Domains Protein: ENSMUSP00000101592
Gene: ENSMUSG00000028906

DomainStartEndE-ValueType
low complexity region 31 53 N/A INTRINSIC
low complexity region 74 94 N/A INTRINSIC
low complexity region 98 121 N/A INTRINSIC
B41 207 402 1.3e-80 SMART
FERM_C 406 496 1.01e-35 SMART
FA 499 545 8.99e-19 SMART
low complexity region 594 607 N/A INTRINSIC
Pfam:SAB 661 709 1.8e-29 PFAM
Pfam:4_1_CTD 741 855 3.5e-57 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105974
SMART Domains Protein: ENSMUSP00000101594
Gene: ENSMUSG00000028906

DomainStartEndE-ValueType
low complexity region 31 53 N/A INTRINSIC
low complexity region 74 94 N/A INTRINSIC
low complexity region 98 121 N/A INTRINSIC
B41 207 367 3.77e-50 SMART
FERM_C 371 461 1.01e-35 SMART
FA 464 510 8.99e-19 SMART
Pfam:SAB 572 620 2e-28 PFAM
Pfam:4_1_CTD 652 766 3e-57 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105975
SMART Domains Protein: ENSMUSP00000101595
Gene: ENSMUSG00000028906

DomainStartEndE-ValueType
low complexity region 31 53 N/A INTRINSIC
low complexity region 74 94 N/A INTRINSIC
low complexity region 98 121 N/A INTRINSIC
B41 232 427 1.3e-80 SMART
FERM_C 431 521 1.01e-35 SMART
FA 524 570 8.99e-19 SMART
low complexity region 619 632 N/A INTRINSIC
Pfam:SAB 672 720 3.9e-25 PFAM
Pfam:4_1_CTD 758 865 2.6e-51 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105981
SMART Domains Protein: ENSMUSP00000101601
Gene: ENSMUSG00000028906

DomainStartEndE-ValueType
low complexity region 31 53 N/A INTRINSIC
low complexity region 74 94 N/A INTRINSIC
low complexity region 98 121 N/A INTRINSIC
B41 207 402 1.3e-80 SMART
FERM_C 406 496 1.01e-35 SMART
FA 499 545 8.99e-19 SMART
low complexity region 594 607 N/A INTRINSIC
Pfam:SAB 661 709 1.8e-29 PFAM
Pfam:4_1_CTD 741 855 3.5e-57 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124738
Predicted Effect probably benign
Transcript: ENSMUST00000135579
SMART Domains Protein: ENSMUSP00000121764
Gene: ENSMUSG00000028906

DomainStartEndE-ValueType
Pfam:SAB 28 76 2e-24 PFAM
low complexity region 148 159 N/A INTRINSIC
low complexity region 206 217 N/A INTRINSIC
Pfam:4_1_CTD 264 371 6.6e-52 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000137846
SMART Domains Protein: ENSMUSP00000123623
Gene: ENSMUSG00000028906

DomainStartEndE-ValueType
B41 49 244 1.3e-80 SMART
FERM_C 248 338 1.01e-35 SMART
FA 341 387 8.99e-19 SMART
low complexity region 431 453 N/A INTRINSIC
Pfam:SAB 470 518 1.2e-29 PFAM
Pfam:4_1_CTD 550 664 2.5e-57 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144754
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146021
Predicted Effect probably benign
Transcript: ENSMUST00000146443
SMART Domains Protein: ENSMUSP00000122234
Gene: ENSMUSG00000028906

DomainStartEndE-ValueType
low complexity region 5 18 N/A INTRINSIC
Pfam:SAB 53 101 7e-26 PFAM
Pfam:4_1_CTD 139 246 2.8e-52 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151746
Predicted Effect probably benign
Transcript: ENSMUST00000155990
SMART Domains Protein: ENSMUSP00000116599
Gene: ENSMUSG00000028906

DomainStartEndE-ValueType
low complexity region 33 44 N/A INTRINSIC
Pfam:4_1_CTD 86 193 1.5e-52 PFAM
Meta Mutation Damage Score 0.1298 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.7%
  • 20x: 90.1%
Validation Efficiency 100% (79/79)
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 A T 11: 110,177,066 I1593N probably benign Het
Akr1b10 G T 6: 34,392,106 K173N probably damaging Het
Artn A T 4: 117,927,676 L3Q probably damaging Het
Asxl3 T A 18: 22,522,718 S1262T possibly damaging Het
Atp6v0a4 A T 6: 38,074,183 M420K probably benign Het
Bcam T A 7: 19,760,101 T422S possibly damaging Het
Casp2 C T 6: 42,269,272 probably benign Het
Ccdc137 A G 11: 120,462,515 probably benign Het
Cd177 C A 7: 24,744,316 A786S probably benign Het
Cdca4 T C 12: 112,821,863 N82D probably benign Het
Clu A C 14: 65,979,728 T337P probably damaging Het
Col6a3 A C 1: 90,779,352 I2013S unknown Het
Cpne9 T A 6: 113,304,488 M510K probably damaging Het
Cyp3a13 A C 5: 137,898,899 N384K possibly damaging Het
Fam186a A C 15: 99,944,646 I1239S possibly damaging Het
Fryl T C 5: 73,075,893 E413G possibly damaging Het
Fscn2 A C 11: 120,366,749 Y312S probably damaging Het
Fshr A T 17: 88,986,046 C401* probably null Het
Glyat A C 19: 12,650,263 Q74P probably damaging Het
Gm5724 A C 6: 141,767,454 M67R possibly damaging Het
Gm6158 A T 14: 24,070,090 noncoding transcript Het
Grm7 A G 6: 110,646,136 N90S probably damaging Het
Hectd1 A T 12: 51,744,879 C2536S probably damaging Het
Herc3 C T 6: 58,855,760 Q137* probably null Het
Kctd3 A C 1: 188,995,693 probably benign Het
Klhl30 A G 1: 91,355,578 T301A probably benign Het
Klra9 T C 6: 130,179,109 K228E possibly damaging Het
Lamc3 A T 2: 31,905,667 T355S possibly damaging Het
Lcmt1 A C 7: 123,410,830 probably null Het
Limch1 C T 5: 66,969,235 P60S probably damaging Het
Lrfn2 A G 17: 49,070,500 D203G probably damaging Het
Mc5r T C 18: 68,339,281 L237P probably damaging Het
Mknk2 G A 10: 80,671,769 R58W probably damaging Het
Mrgpra2b T C 7: 47,502,928 probably benign Het
Mroh2a GCCC GC 1: 88,232,257 probably null Het
Nae1 A T 8: 104,516,702 C395S possibly damaging Het
Ncoa1 A G 12: 4,259,333 M1321T probably damaging Het
Neb A C 2: 52,280,501 F1720V possibly damaging Het
Nectin2 C T 7: 19,738,273 V64I probably benign Het
Nisch T A 14: 31,172,440 T1145S probably damaging Het
Nlrp5 A T 7: 23,435,910 R1009* probably null Het
Olfr103 A T 17: 37,336,931 H100Q probably damaging Het
Olfr727 T A 14: 50,127,437 Y287N probably damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pak1ip1 A G 13: 41,008,145 probably benign Het
Pcm1 T C 8: 41,259,260 V189A probably damaging Het
Peak1 G T 9: 56,260,289 N118K probably damaging Het
Phgdh T A 3: 98,328,339 I121F probably damaging Het
Pi4ka G T 16: 17,309,397 A1064E probably benign Het
Pkhd1 A C 1: 20,585,711 C199W probably benign Het
Plat A G 8: 22,772,311 D117G probably benign Het
Ppp2r2b C A 18: 42,688,461 V211L possibly damaging Het
Ptgs1 A G 2: 36,237,282 D60G probably damaging Het
Ryr2 T C 13: 11,700,354 E2776G probably damaging Het
Sema4c C T 1: 36,552,978 probably null Het
Sharpin T C 15: 76,347,611 probably benign Het
Slamf6 A G 1: 171,936,533 I164M possibly damaging Het
Spef1 A G 2: 131,173,281 Y46H probably damaging Het
Spns1 G A 7: 126,374,329 probably benign Het
Supt5 C T 7: 28,329,015 probably null Het
Tbx5 T A 5: 119,836,922 D3E probably damaging Het
Thbs1 T C 2: 118,121,237 probably null Het
Tmem140 G A 6: 34,872,962 V138M probably damaging Het
Tmem200a T A 10: 25,993,915 D152V probably damaging Het
Tns1 A T 1: 73,952,864 L885Q probably damaging Het
Umod G A 7: 119,472,421 Q366* probably null Het
Vsir A G 10: 60,364,263 I208V probably damaging Het
Zfp646 G A 7: 127,880,499 R616H probably damaging Het
Other mutations in Tmem200b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01363:Tmem200b APN 4 131922393 missense probably benign 0.00
R4366:Tmem200b UTSW 4 131922470 missense possibly damaging 0.53
R7098:Tmem200b UTSW 4 131922393 missense probably benign 0.10
X0057:Tmem200b UTSW 4 131922317 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCACAGCTACCCGTTGAAG -3'
(R):5'- TTAACACATGCCCCTGGAG -3'

Sequencing Primer
(F):5'- CGTTGAAGGGCCCGGGG -3'
(R):5'- TGCTACACATGCAGGTCAG -3'
Posted On2016-06-06