Mutagenetix > Incidental Mutations

Incidental Mutation 'R5062:Tbx5'

386672

Institutional Source

Beutler Lab

Gene Symbol

Tbx5

Ensembl Gene

ENSMUSG00000018263

Gene Name

T-box 5

Synonyms

MMRRC Submission

042652-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.930) question?

Stock #

R5062 (G1)

Quality Score

200

Status

Validated

Chromosome

Chromosomal Location

119832668-119885219 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 119836922 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 3 (D3E)

Ref Sequence

ENSEMBL: ENSMUSP00000018407 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000018407] [ENSMUST00000202504] [ENSMUST00000202723]

Predicted Effect

probably damaging
Transcript: ENSMUST00000018407
AA Change: D3E

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000018407
Gene: ENSMUSG00000018263
AA Change: D3E

Domain	Start	End	E-Value	Type
low complexity region	34	45	N/A	INTRINSIC
TBOX	53	243	9.61e-129	SMART
low complexity region	381	392	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000202504
AA Change: D3E

PolyPhen 2 Score 0.042 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000143828
Gene: ENSMUSG00000018263
AA Change: D3E

Domain	Start	End	E-Value	Type
low complexity region	34	45	N/A	INTRINSIC
TBOX	53	218	6.3e-100	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000202723
AA Change: D3E

PolyPhen 2 Score 0.507 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000144418
Gene: ENSMUSG00000018263
AA Change: D3E

Domain	Start	End	E-Value	Type
low complexity region	34	45	N/A	INTRINSIC
TBOX	53	120	3.1e-9	SMART

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.0%
3x: 98.2%
10x: 95.7%
20x: 90.1%

Validation Efficiency

100% (79/79)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of a phylogenetically conserved family of genes that share a common DNA-binding domain, the T-box. T-box genes encode transcription factors involved in the regulation of developmental processes. This gene is closely linked to related family member T-box 3 (ulnar mammary syndrome) on human chromosome 12. The encoded protein may play a role in heart development and specification of limb identity. Mutations in this gene have been associated with Holt-Oram syndrome, a developmental disorder affecting the heart and upper limbs. Several transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Heterozygous null mice exhibit strain-dependent perinatal lethality, forelimb and variable congenital heart malformations, whereas homozygous null mice are growth arrested and die by E10.5 of severe heart defects. Hypomorphic mutants show milder defects both in the hetero- and homozygous null state. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca6	A	T	11: 110,177,066	I1593N	probably benign	Het
Akr1b10	G	T	6: 34,392,106	K173N	probably damaging	Het
Artn	A	T	4: 117,927,676	L3Q	probably damaging	Het
Asxl3	T	A	18: 22,522,718	S1262T	possibly damaging	Het
Atp6v0a4	A	T	6: 38,074,183	M420K	probably benign	Het
Bcam	T	A	7: 19,760,101	T422S	possibly damaging	Het
Casp2	C	T	6: 42,269,272		probably benign	Het
Ccdc137	A	G	11: 120,462,515		probably benign	Het
Cd177	C	A	7: 24,744,316	A786S	probably benign	Het
Cdca4	T	C	12: 112,821,863	N82D	probably benign	Het
Clu	A	C	14: 65,979,728	T337P	probably damaging	Het
Col6a3	A	C	1: 90,779,352	I2013S	unknown	Het
Cpne9	T	A	6: 113,304,488	M510K	probably damaging	Het
Cyp3a13	A	C	5: 137,898,899	N384K	possibly damaging	Het
Fam186a	A	C	15: 99,944,646	I1239S	possibly damaging	Het
Fryl	T	C	5: 73,075,893	E413G	possibly damaging	Het
Fscn2	A	C	11: 120,366,749	Y312S	probably damaging	Het
Fshr	A	T	17: 88,986,046	C401*	probably null	Het
Glyat	A	C	19: 12,650,263	Q74P	probably damaging	Het
Gm5724	A	C	6: 141,767,454	M67R	possibly damaging	Het
Gm6158	A	T	14: 24,070,090		noncoding transcript	Het
Grm7	A	G	6: 110,646,136	N90S	probably damaging	Het
Hectd1	A	T	12: 51,744,879	C2536S	probably damaging	Het
Herc3	C	T	6: 58,855,760	Q137*	probably null	Het
Kctd3	A	C	1: 188,995,693		probably benign	Het
Klhl30	A	G	1: 91,355,578	T301A	probably benign	Het
Klra9	T	C	6: 130,179,109	K228E	possibly damaging	Het
Lamc3	A	T	2: 31,905,667	T355S	possibly damaging	Het
Lcmt1	A	C	7: 123,410,830		probably null	Het
Limch1	C	T	5: 66,969,235	P60S	probably damaging	Het
Lrfn2	A	G	17: 49,070,500	D203G	probably damaging	Het
Mc5r	T	C	18: 68,339,281	L237P	probably damaging	Het
Mknk2	G	A	10: 80,671,769	R58W	probably damaging	Het
Mrgpra2b	T	C	7: 47,502,928		probably benign	Het
Mroh2a	GCCC	GC	1: 88,232,257		probably null	Het
Nae1	A	T	8: 104,516,702	C395S	possibly damaging	Het
Ncoa1	A	G	12: 4,259,333	M1321T	probably damaging	Het
Neb	A	C	2: 52,280,501	F1720V	possibly damaging	Het
Nectin2	C	T	7: 19,738,273	V64I	probably benign	Het
Nisch	T	A	14: 31,172,440	T1145S	probably damaging	Het
Nlrp5	A	T	7: 23,435,910	R1009*	probably null	Het
Olfr103	A	T	17: 37,336,931	H100Q	probably damaging	Het
Olfr727	T	A	14: 50,127,437	Y287N	probably damaging	Het
Otx1	C	A	11: 21,997,037	A91S	probably damaging	Het
Pak1ip1	A	G	13: 41,008,145		probably benign	Het
Pcm1	T	C	8: 41,259,260	V189A	probably damaging	Het
Peak1	G	T	9: 56,260,289	N118K	probably damaging	Het
Phgdh	T	A	3: 98,328,339	I121F	probably damaging	Het
Pi4ka	G	T	16: 17,309,397	A1064E	probably benign	Het
Pkhd1	A	C	1: 20,585,711	C199W	probably benign	Het
Plat	A	G	8: 22,772,311	D117G	probably benign	Het
Ppp2r2b	C	A	18: 42,688,461	V211L	possibly damaging	Het
Ptgs1	A	G	2: 36,237,282	D60G	probably damaging	Het
Ryr2	T	C	13: 11,700,354	E2776G	probably damaging	Het
Sema4c	C	T	1: 36,552,978		probably null	Het
Sharpin	T	C	15: 76,347,611		probably benign	Het
Slamf6	A	G	1: 171,936,533	I164M	possibly damaging	Het
Spef1	A	G	2: 131,173,281	Y46H	probably damaging	Het
Spns1	G	A	7: 126,374,329		probably benign	Het
Supt5	C	T	7: 28,329,015		probably null	Het
Thbs1	T	C	2: 118,121,237		probably null	Het
Tmem140	G	A	6: 34,872,962	V138M	probably damaging	Het
Tmem200a	T	A	10: 25,993,915	D152V	probably damaging	Het
Tmem200b	A	G	4: 131,922,537	D256G	probably damaging	Het
Tns1	A	T	1: 73,952,864	L885Q	probably damaging	Het
Umod	G	A	7: 119,472,421	Q366*	probably null	Het
Vsir	A	G	10: 60,364,263	I208V	probably damaging	Het
Zfp646	G	A	7: 127,880,499	R616H	probably damaging	Het

Other mutations in Tbx5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01096:Tbx5	APN	5	119883026	missense	probably benign
IGL01595:Tbx5	APN	5	119840838	missense	probably damaging	1.00
IGL01758:Tbx5	APN	5	119844958	unclassified	probably benign
IGL02239:Tbx5	APN	5	119871280	missense	possibly damaging	0.68
IGL02625:Tbx5	APN	5	119836907	utr 5 prime	probably benign
IGL03326:Tbx5	APN	5	119871298	missense	probably damaging	0.99
R0477:Tbx5	UTSW	5	119883119	missense	possibly damaging	0.89
R0485:Tbx5	UTSW	5	119883458	missense	probably benign	0.00
R1218:Tbx5	UTSW	5	119838720	missense	probably damaging	1.00
R1756:Tbx5	UTSW	5	119845113	splice site	probably null
R2011:Tbx5	UTSW	5	119841906	splice site	probably null
R2125:Tbx5	UTSW	5	119836923	missense	probably benign
R2126:Tbx5	UTSW	5	119836923	missense	probably benign
R2268:Tbx5	UTSW	5	119845109	splice site	probably null
R2302:Tbx5	UTSW	5	119841859	missense	probably damaging	1.00
R4693:Tbx5	UTSW	5	119841899	missense	probably damaging	1.00
R4930:Tbx5	UTSW	5	119883025	missense	probably benign	0.44
R5245:Tbx5	UTSW	5	119883165	missense	possibly damaging	0.95
R6067:Tbx5	UTSW	5	119883146	missense	probably benign
R6079:Tbx5	UTSW	5	119883146	missense	probably benign
R6138:Tbx5	UTSW	5	119883146	missense	probably benign
R6218:Tbx5	UTSW	5	119853598	missense	probably damaging	1.00
R6528:Tbx5	UTSW	5	119883111	missense	probably damaging	0.97
R6700:Tbx5	UTSW	5	119871397	missense	probably benign	0.30
R6993:Tbx5	UTSW	5	119871389	missense	possibly damaging	0.75
R7777:Tbx5	UTSW	5	119883167	missense	probably benign	0.00
R7801:Tbx5	UTSW	5	119836999	missense	probably benign	0.44
R8056:Tbx5	UTSW	5	119853613	missense	probably benign
R8772:Tbx5	UTSW	5	119838725	missense	probably benign	0.02
U15987:Tbx5	UTSW	5	119883146	missense	probably benign
X0028:Tbx5	UTSW	5	119845119	critical splice donor site	probably null
Z1176:Tbx5	UTSW	5	119883315	missense	probably benign	0.03

Predicted Primers

PCR Primer
(F):5'- TGCGTGGTCGGAAAGTATAAC -3'
(R):5'- ATAGAGGGAATAGCTGGCCC -3'

Sequencing Primer
(F):5'- CCTATGTCGCTAGACACT -3'
(R):5'- TGCACCGTTAGCAGAGAGC -3'

Posted On

2016-06-06