Mutagenetix > Incidental Mutations

Incidental Mutation 'R5062:Grm7'

386679

Institutional Source

Beutler Lab

Gene Symbol

Grm7

Ensembl Gene

ENSMUSG00000056755

Gene Name

glutamate receptor, metabotropic 7

Synonyms

Gpr1g, mGlu7a receptor, mGluR7, E130018M02Rik, 6330570A01Rik

MMRRC Submission

042652-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5062 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

110645581-111567230 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 110646136 bp

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 90 (N90S)

Ref Sequence

ENSEMBL: ENSMUSP00000134635 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000071076] [ENSMUST00000172951] [ENSMUST00000174018]

Predicted Effect

probably damaging
Transcript: ENSMUST00000071076
AA Change: N90S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000064404
Gene: ENSMUSG00000056755
AA Change: N90S

Domain	Start	End	E-Value	Type
low complexity region	18	32	N/A	INTRINSIC
Pfam:ANF_receptor	77	484	3e-108	PFAM
Pfam:Peripla_BP_6	144	371	3e-11	PFAM
Pfam:NCD3G	519	569	1.2e-13	PFAM
Pfam:7tm_3	602	847	5.1e-59	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000172951
AA Change: N90S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000133957
Gene: ENSMUSG00000056755
AA Change: N90S

Domain	Start	End	E-Value	Type
low complexity region	18	32	N/A	INTRINSIC
Pfam:ANF_receptor	77	484	1.7e-103	PFAM
Pfam:Peripla_BP_6	144	487	1e-12	PFAM
Pfam:NCD3G	519	569	1.2e-17	PFAM
Pfam:7tm_3	600	848	1.4e-87	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000173609

Predicted Effect

probably damaging
Transcript: ENSMUST00000174018
AA Change: N90S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000134635
Gene: ENSMUSG00000056755
AA Change: N90S

Domain	Start	End	E-Value	Type
low complexity region	18	32	N/A	INTRINSIC
Pfam:ANF_receptor	77	176	4.9e-20	PFAM

Meta Mutation Damage Score

0.3982

Coding Region Coverage

1x: 99.0%
3x: 98.2%
10x: 95.7%
20x: 90.1%

Validation Efficiency

100% (79/79)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] L-glutamate is the major excitatory neurotransmitter in the central nervous system, and it activates both ionotropic and metabotropic glutamate receptors. Glutamatergic neurotransmission is involved in most aspects of normal brain function and can be perturbed in many neuropathologic conditions. The metabotropic glutamate receptors are a family of G protein-coupled receptors that have been divided into three groups on the basis of sequence homology, putative signal transduction mechanisms, and pharmacologic properties. Group I includes GRM1 and GRM5, and these receptors have been shown to activate phospholipase C. Group II includes GRM2 and GRM3, while Group III includes GRM4, GRM6, GRM7 and GRM8. Group II and III receptors are linked to the inhibition of the cyclic AMP cascade but differ in their agonist selectivities. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2009]
PHENOTYPE: Nullizygous mice exhibit epilepsy and deficits in fear response and conditioned taste aversion. Homozygotes for a knock-in allele show impaired spatial working memory and higher susceptibility to PTZ. Homozygotes for a reporter allele show impaired coordination and higher susceptibility to metrazol. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca6	A	T	11: 110,177,066	I1593N	probably benign	Het
Akr1b10	G	T	6: 34,392,106	K173N	probably damaging	Het
Artn	A	T	4: 117,927,676	L3Q	probably damaging	Het
Asxl3	T	A	18: 22,522,718	S1262T	possibly damaging	Het
Atp6v0a4	A	T	6: 38,074,183	M420K	probably benign	Het
Bcam	T	A	7: 19,760,101	T422S	possibly damaging	Het
Casp2	C	T	6: 42,269,272		probably benign	Het
Ccdc137	A	G	11: 120,462,515		probably benign	Het
Cd177	C	A	7: 24,744,316	A786S	probably benign	Het
Cdca4	T	C	12: 112,821,863	N82D	probably benign	Het
Clu	A	C	14: 65,979,728	T337P	probably damaging	Het
Col6a3	A	C	1: 90,779,352	I2013S	unknown	Het
Cpne9	T	A	6: 113,304,488	M510K	probably damaging	Het
Cyp3a13	A	C	5: 137,898,899	N384K	possibly damaging	Het
Fam186a	A	C	15: 99,944,646	I1239S	possibly damaging	Het
Fryl	T	C	5: 73,075,893	E413G	possibly damaging	Het
Fscn2	A	C	11: 120,366,749	Y312S	probably damaging	Het
Fshr	A	T	17: 88,986,046	C401*	probably null	Het
Glyat	A	C	19: 12,650,263	Q74P	probably damaging	Het
Gm5724	A	C	6: 141,767,454	M67R	possibly damaging	Het
Gm6158	A	T	14: 24,070,090		noncoding transcript	Het
Hectd1	A	T	12: 51,744,879	C2536S	probably damaging	Het
Herc3	C	T	6: 58,855,760	Q137*	probably null	Het
Kctd3	A	C	1: 188,995,693		probably benign	Het
Klhl30	A	G	1: 91,355,578	T301A	probably benign	Het
Klra9	T	C	6: 130,179,109	K228E	possibly damaging	Het
Lamc3	A	T	2: 31,905,667	T355S	possibly damaging	Het
Lcmt1	A	C	7: 123,410,830		probably null	Het
Limch1	C	T	5: 66,969,235	P60S	probably damaging	Het
Lrfn2	A	G	17: 49,070,500	D203G	probably damaging	Het
Mc5r	T	C	18: 68,339,281	L237P	probably damaging	Het
Mknk2	G	A	10: 80,671,769	R58W	probably damaging	Het
Mrgpra2b	T	C	7: 47,502,928		probably benign	Het
Mroh2a	GCCC	GC	1: 88,232,257		probably null	Het
Nae1	A	T	8: 104,516,702	C395S	possibly damaging	Het
Ncoa1	A	G	12: 4,259,333	M1321T	probably damaging	Het
Neb	A	C	2: 52,280,501	F1720V	possibly damaging	Het
Nectin2	C	T	7: 19,738,273	V64I	probably benign	Het
Nisch	T	A	14: 31,172,440	T1145S	probably damaging	Het
Nlrp5	A	T	7: 23,435,910	R1009*	probably null	Het
Olfr103	A	T	17: 37,336,931	H100Q	probably damaging	Het
Olfr727	T	A	14: 50,127,437	Y287N	probably damaging	Het
Otx1	C	A	11: 21,997,037	A91S	probably damaging	Het
Pak1ip1	A	G	13: 41,008,145		probably benign	Het
Pcm1	T	C	8: 41,259,260	V189A	probably damaging	Het
Peak1	G	T	9: 56,260,289	N118K	probably damaging	Het
Phgdh	T	A	3: 98,328,339	I121F	probably damaging	Het
Pi4ka	G	T	16: 17,309,397	A1064E	probably benign	Het
Pkhd1	A	C	1: 20,585,711	C199W	probably benign	Het
Plat	A	G	8: 22,772,311	D117G	probably benign	Het
Ppp2r2b	C	A	18: 42,688,461	V211L	possibly damaging	Het
Ptgs1	A	G	2: 36,237,282	D60G	probably damaging	Het
Ryr2	T	C	13: 11,700,354	E2776G	probably damaging	Het
Sema4c	C	T	1: 36,552,978		probably null	Het
Sharpin	T	C	15: 76,347,611		probably benign	Het
Slamf6	A	G	1: 171,936,533	I164M	possibly damaging	Het
Spef1	A	G	2: 131,173,281	Y46H	probably damaging	Het
Spns1	G	A	7: 126,374,329		probably benign	Het
Supt5	C	T	7: 28,329,015		probably null	Het
Tbx5	T	A	5: 119,836,922	D3E	probably damaging	Het
Thbs1	T	C	2: 118,121,237		probably null	Het
Tmem140	G	A	6: 34,872,962	V138M	probably damaging	Het
Tmem200a	T	A	10: 25,993,915	D152V	probably damaging	Het
Tmem200b	A	G	4: 131,922,537	D256G	probably damaging	Het
Tns1	A	T	1: 73,952,864	L885Q	probably damaging	Het
Umod	G	A	7: 119,472,421	Q366*	probably null	Het
Vsir	A	G	10: 60,364,263	I208V	probably damaging	Het
Zfp646	G	A	7: 127,880,499	R616H	probably damaging	Het

Other mutations in Grm7

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01729:Grm7	APN	6	111246184	missense	probably benign	0.14
IGL02058:Grm7	APN	6	111358317	missense	probably damaging	1.00
IGL02650:Grm7	APN	6	111358958	missense	probably damaging	1.00
IGL02892:Grm7	APN	6	111254020	missense	probably damaging	0.99
IGL03074:Grm7	APN	6	111495643	splice site	probably null
IGL03185:Grm7	APN	6	110646222	missense	possibly damaging	0.84
Appropriated	UTSW	6	111495681	missense	possibly damaging	0.64
Consumed	UTSW	6	111358875	missense	probably damaging	1.00
Devoured	UTSW	6	111358824	missense	probably damaging	1.00
shaky	UTSW	6	111495791	nonsense	probably null
PIT4651001:Grm7	UTSW	6	110646089	missense	probably benign
R0539:Grm7	UTSW	6	111359094	splice site	probably benign
R0622:Grm7	UTSW	6	111358496	missense	probably damaging	1.00
R1356:Grm7	UTSW	6	111359024	missense	probably damaging	1.00
R1762:Grm7	UTSW	6	111358295	missense	probably damaging	1.00
R1783:Grm7	UTSW	6	111358295	missense	probably damaging	1.00
R1785:Grm7	UTSW	6	111358295	missense	probably damaging	1.00
R1816:Grm7	UTSW	6	111495791	nonsense	probably null
R1823:Grm7	UTSW	6	111207769	missense	probably benign	0.17
R1864:Grm7	UTSW	6	111080423	missense	probably benign	0.03
R1894:Grm7	UTSW	6	111358607	missense	probably benign
R1987:Grm7	UTSW	6	110914511	missense	probably damaging	1.00
R1993:Grm7	UTSW	6	111207808	missense	probably benign	0.13
R2138:Grm7	UTSW	6	110646137	missense	probably damaging	1.00
R2214:Grm7	UTSW	6	111358997	missense	probably damaging	1.00
R2289:Grm7	UTSW	6	110646348	missense	probably damaging	1.00
R2296:Grm7	UTSW	6	110646348	missense	probably damaging	1.00
R2339:Grm7	UTSW	6	111495681	missense	possibly damaging	0.64
R2847:Grm7	UTSW	6	110646348	missense	probably damaging	1.00
R2849:Grm7	UTSW	6	110646348	missense	probably damaging	1.00
R2879:Grm7	UTSW	6	110646348	missense	probably damaging	1.00
R2884:Grm7	UTSW	6	110646348	missense	probably damaging	1.00
R2921:Grm7	UTSW	6	111495905	splice site	probably null
R2923:Grm7	UTSW	6	111495905	splice site	probably null
R3014:Grm7	UTSW	6	110646348	missense	probably damaging	1.00
R3015:Grm7	UTSW	6	110646348	missense	probably damaging	1.00
R3703:Grm7	UTSW	6	110646348	missense	probably damaging	1.00
R3713:Grm7	UTSW	6	110646348	missense	probably damaging	1.00
R3963:Grm7	UTSW	6	110646348	missense	probably damaging	1.00
R4009:Grm7	UTSW	6	111495722	missense	probably damaging	1.00
R4091:Grm7	UTSW	6	110914340	missense	probably damaging	1.00
R4131:Grm7	UTSW	6	110646348	missense	probably damaging	1.00
R4132:Grm7	UTSW	6	110646348	missense	probably damaging	1.00
R4161:Grm7	UTSW	6	111254020	missense	probably damaging	0.99
R4329:Grm7	UTSW	6	110914364	missense	probably damaging	1.00
R4357:Grm7	UTSW	6	110646348	missense	probably damaging	1.00
R4359:Grm7	UTSW	6	110646348	missense	probably damaging	1.00
R4379:Grm7	UTSW	6	110646348	missense	probably damaging	1.00
R4379:Grm7	UTSW	6	111246374	missense	probably benign	0.05
R4380:Grm7	UTSW	6	110646348	missense	probably damaging	1.00
R4514:Grm7	UTSW	6	111358304	missense	possibly damaging	0.81
R4518:Grm7	UTSW	6	110914546	splice site	probably null
R4647:Grm7	UTSW	6	110914383	nonsense	probably null
R4714:Grm7	UTSW	6	111080422	missense	possibly damaging	0.52
R4775:Grm7	UTSW	6	110914371	missense	probably damaging	1.00
R4957:Grm7	UTSW	6	111358863	missense	probably damaging	1.00
R5056:Grm7	UTSW	6	111080443	missense	probably damaging	0.99
R5256:Grm7	UTSW	6	111358221	missense	probably benign	0.01
R5431:Grm7	UTSW	6	111358426	missense	probably benign
R6026:Grm7	UTSW	6	111501539	nonsense	probably null
R6174:Grm7	UTSW	6	111246297	missense	probably benign
R6305:Grm7	UTSW	6	111358665	missense	probably damaging	1.00
R6318:Grm7	UTSW	6	111358875	missense	probably damaging	1.00
R6440:Grm7	UTSW	6	111254020	missense	probably damaging	1.00
R6519:Grm7	UTSW	6	111207752	missense	probably benign	0.00
R6531:Grm7	UTSW	6	111358425	missense	probably benign	0.29
R6888:Grm7	UTSW	6	111358353	missense	possibly damaging	0.79
R6949:Grm7	UTSW	6	110646304	missense	probably benign	0.03
R6949:Grm7	UTSW	6	111495729	missense	probably damaging	1.00
R6989:Grm7	UTSW	6	111207805	missense	probably damaging	1.00
R7076:Grm7	UTSW	6	111358152	missense	probably benign	0.04
R7203:Grm7	UTSW	6	111358569	missense	possibly damaging	0.94
R7208:Grm7	UTSW	6	111358569	missense	possibly damaging	0.94
R7217:Grm7	UTSW	6	111358824	missense	probably damaging	1.00
R7257:Grm7	UTSW	6	110646118	missense	probably damaging	1.00
R7297:Grm7	UTSW	6	110646013	missense	probably benign	0.16
R7470:Grm7	UTSW	6	111501515	missense
R7567:Grm7	UTSW	6	111358761	missense	probably damaging	0.96
R7806:Grm7	UTSW	6	111246353	nonsense	probably null
R8018:Grm7	UTSW	6	111207776	missense	probably benign	0.01
R8076:Grm7	UTSW	6	111566039	missense	probably damaging	1.00
R8409:Grm7	UTSW	6	110914336	missense	probably benign	0.02
R8420:Grm7	UTSW	6	111080354	missense	probably benign
Z1176:Grm7	UTSW	6	111358149	missense	probably benign	0.01
Z1176:Grm7	UTSW	6	111358490	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TTGATGAAGTTCCCCTGCTG -3'
(R):5'- TCTGGCTTGACGAAAACCG -3'

Sequencing Primer
(F):5'- AGGTGCTCCTGTGCGTGC -3'
(R):5'- CTTGACGAAAACCGGGGGC -3'

Posted On

2016-06-06