Incidental Mutation 'R5062:Nectin2'
ID 386682
Institutional Source Beutler Lab
Gene Symbol Nectin2
Ensembl Gene ENSMUSG00000062300
Gene Name nectin cell adhesion molecule 2
Synonyms MPH, nectin-2, Cd112, Pvs, Pvrl2
MMRRC Submission 042652-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.138) question?
Stock # R5062 (G1)
Quality Score 174
Status Validated
Chromosome 7
Chromosomal Location 19716644-19750483 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 19738273 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Isoleucine at position 64 (V64I)
Ref Sequence ENSEMBL: ENSMUSP00000104089 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075447] [ENSMUST00000108450]
AlphaFold P32507
Predicted Effect probably benign
Transcript: ENSMUST00000075447
AA Change: V64I

PolyPhen 2 Score 0.093 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000074898
Gene: ENSMUSG00000062300
AA Change: V64I

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
IGv 49 133 3.59e-14 SMART
IG_like 159 249 5.31e1 SMART
IG_like 261 338 8.12e1 SMART
transmembrane domain 351 373 N/A INTRINSIC
low complexity region 455 478 N/A INTRINSIC
low complexity region 486 496 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108450
AA Change: V64I

PolyPhen 2 Score 0.093 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000104089
Gene: ENSMUSG00000062300
AA Change: V64I

DomainStartEndE-ValueType
low complexity region 7 26 N/A INTRINSIC
IGv 49 133 3.59e-14 SMART
IG_like 159 249 5.31e1 SMART
IG_like 261 338 8.12e1 SMART
transmembrane domain 351 373 N/A INTRINSIC
low complexity region 416 438 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207271
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.7%
  • 20x: 90.1%
Validation Efficiency 100% (79/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a single-pass type I membrane glycoprotein with two Ig-like C2-type domains and an Ig-like V-type domain. This protein is one of the plasma membrane components of adherens junctions. It also serves as an entry for certain mutant strains of herpes simplex virus and pseudorabies virus, and it is involved in cell to cell spreading of these viruses. Variations in this gene have been associated with differences in the severity of multiple sclerosis. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for targeted null mutations exhibit male sterility associated with sperm head and midpiece malformation, impaired zona binding, and lack of oocyte penetration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 A T 11: 110,177,066 I1593N probably benign Het
Akr1b10 G T 6: 34,392,106 K173N probably damaging Het
Artn A T 4: 117,927,676 L3Q probably damaging Het
Asxl3 T A 18: 22,522,718 S1262T possibly damaging Het
Atp6v0a4 A T 6: 38,074,183 M420K probably benign Het
Bcam T A 7: 19,760,101 T422S possibly damaging Het
Casp2 C T 6: 42,269,272 probably benign Het
Ccdc137 A G 11: 120,462,515 probably benign Het
Cd177 C A 7: 24,744,316 A786S probably benign Het
Cdca4 T C 12: 112,821,863 N82D probably benign Het
Clu A C 14: 65,979,728 T337P probably damaging Het
Col6a3 A C 1: 90,779,352 I2013S unknown Het
Cpne9 T A 6: 113,304,488 M510K probably damaging Het
Cyp3a13 A C 5: 137,898,899 N384K possibly damaging Het
Fam186a A C 15: 99,944,646 I1239S possibly damaging Het
Fryl T C 5: 73,075,893 E413G possibly damaging Het
Fscn2 A C 11: 120,366,749 Y312S probably damaging Het
Fshr A T 17: 88,986,046 C401* probably null Het
Glyat A C 19: 12,650,263 Q74P probably damaging Het
Gm5724 A C 6: 141,767,454 M67R possibly damaging Het
Gm6158 A T 14: 24,070,090 noncoding transcript Het
Grm7 A G 6: 110,646,136 N90S probably damaging Het
Hectd1 A T 12: 51,744,879 C2536S probably damaging Het
Herc3 C T 6: 58,855,760 Q137* probably null Het
Kctd3 A C 1: 188,995,693 probably benign Het
Klhl30 A G 1: 91,355,578 T301A probably benign Het
Klra9 T C 6: 130,179,109 K228E possibly damaging Het
Lamc3 A T 2: 31,905,667 T355S possibly damaging Het
Lcmt1 A C 7: 123,410,830 probably null Het
Limch1 C T 5: 66,969,235 P60S probably damaging Het
Lrfn2 A G 17: 49,070,500 D203G probably damaging Het
Mc5r T C 18: 68,339,281 L237P probably damaging Het
Mknk2 G A 10: 80,671,769 R58W probably damaging Het
Mrgpra2b T C 7: 47,502,928 probably benign Het
Mroh2a GCCC GC 1: 88,232,257 probably null Het
Nae1 A T 8: 104,516,702 C395S possibly damaging Het
Ncoa1 A G 12: 4,259,333 M1321T probably damaging Het
Neb A C 2: 52,280,501 F1720V possibly damaging Het
Nisch T A 14: 31,172,440 T1145S probably damaging Het
Nlrp5 A T 7: 23,435,910 R1009* probably null Het
Olfr103 A T 17: 37,336,931 H100Q probably damaging Het
Olfr727 T A 14: 50,127,437 Y287N probably damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pak1ip1 A G 13: 41,008,145 probably benign Het
Pcm1 T C 8: 41,259,260 V189A probably damaging Het
Peak1 G T 9: 56,260,289 N118K probably damaging Het
Phgdh T A 3: 98,328,339 I121F probably damaging Het
Pi4ka G T 16: 17,309,397 A1064E probably benign Het
Pkhd1 A C 1: 20,585,711 C199W probably benign Het
Plat A G 8: 22,772,311 D117G probably benign Het
Ppp2r2b C A 18: 42,688,461 V211L possibly damaging Het
Ptgs1 A G 2: 36,237,282 D60G probably damaging Het
Ryr2 T C 13: 11,700,354 E2776G probably damaging Het
Sema4c C T 1: 36,552,978 probably null Het
Sharpin T C 15: 76,347,611 probably benign Het
Slamf6 A G 1: 171,936,533 I164M possibly damaging Het
Spef1 A G 2: 131,173,281 Y46H probably damaging Het
Spns1 G A 7: 126,374,329 probably benign Het
Supt5 C T 7: 28,329,015 probably null Het
Tbx5 T A 5: 119,836,922 D3E probably damaging Het
Thbs1 T C 2: 118,121,237 probably null Het
Tmem140 G A 6: 34,872,962 V138M probably damaging Het
Tmem200a T A 10: 25,993,915 D152V probably damaging Het
Tmem200b A G 4: 131,922,537 D256G probably damaging Het
Tns1 A T 1: 73,952,864 L885Q probably damaging Het
Umod G A 7: 119,472,421 Q366* probably null Het
Vsir A G 10: 60,364,263 I208V probably damaging Het
Zfp646 G A 7: 127,880,499 R616H probably damaging Het
Other mutations in Nectin2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01982:Nectin2 APN 7 19717562 missense probably damaging 1.00
IGL03184:Nectin2 APN 7 19738306 missense possibly damaging 0.86
PIT4458001:Nectin2 UTSW 7 19738327 missense probably benign 0.19
R0012:Nectin2 UTSW 7 19730744 splice site probably benign
R0012:Nectin2 UTSW 7 19730744 splice site probably benign
R0555:Nectin2 UTSW 7 19733223 splice site probably benign
R0764:Nectin2 UTSW 7 19749171 splice site probably null
R1252:Nectin2 UTSW 7 19717598 missense probably benign 0.18
R1465:Nectin2 UTSW 7 19730116 missense probably benign
R1465:Nectin2 UTSW 7 19730116 missense probably benign
R1833:Nectin2 UTSW 7 19717708 missense probably damaging 0.96
R2115:Nectin2 UTSW 7 19717564 missense probably damaging 0.98
R2168:Nectin2 UTSW 7 19730614 missense probably damaging 0.98
R3801:Nectin2 UTSW 7 19717636 missense probably benign
R3825:Nectin2 UTSW 7 19724585 missense possibly damaging 0.94
R4877:Nectin2 UTSW 7 19717720 missense possibly damaging 0.55
R5082:Nectin2 UTSW 7 19738124 missense probably damaging 0.99
R5693:Nectin2 UTSW 7 19724869 missense probably benign 0.00
R6042:Nectin2 UTSW 7 19738138 missense probably benign 0.01
R6060:Nectin2 UTSW 7 19717775 missense probably damaging 1.00
R6657:Nectin2 UTSW 7 19738140 missense probably benign 0.41
R7437:Nectin2 UTSW 7 19749268 nonsense probably null
R7476:Nectin2 UTSW 7 19717621 missense possibly damaging 0.82
R7523:Nectin2 UTSW 7 19730112 missense probably benign 0.00
R7538:Nectin2 UTSW 7 19730619 missense probably damaging 1.00
R7910:Nectin2 UTSW 7 19732987 nonsense probably null
R8181:Nectin2 UTSW 7 19724808 missense probably damaging 1.00
R8394:Nectin2 UTSW 7 19733212 critical splice acceptor site probably null
R8406:Nectin2 UTSW 7 19738350 missense probably damaging 0.99
R8419:Nectin2 UTSW 7 19717721 missense probably benign 0.00
R8419:Nectin2 UTSW 7 19738078 missense probably damaging 1.00
R9188:Nectin2 UTSW 7 19719194 critical splice donor site probably null
Z1176:Nectin2 UTSW 7 19738363 missense probably benign 0.15
Predicted Primers PCR Primer
(F):5'- AAACGTGGCAAACTCGCAG -3'
(R):5'- TCCTTGGTAGAGATGCCTGAC -3'

Sequencing Primer
(F):5'- AACTCGCAGGTGTAATTGCC -3'
(R):5'- AGATGCCTGACCTGGAGATCTC -3'
Posted On 2016-06-06