Incidental Mutation 'R5062:Bcam'
ID386683
Institutional Source Beutler Lab
Gene Symbol Bcam
Ensembl Gene ENSMUSG00000002980
Gene Namebasal cell adhesion molecule
Synonyms1200005K12Rik, Lu, B-CAM
MMRRC Submission 042652-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5062 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location19756131-19771016 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 19760101 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 422 (T422S)
Ref Sequence ENSEMBL: ENSMUSP00000003061 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003061]
Predicted Effect possibly damaging
Transcript: ENSMUST00000003061
AA Change: T422S

PolyPhen 2 Score 0.615 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000003061
Gene: ENSMUSG00000002980
AA Change: T422S

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
IG 32 137 3.1e-9 SMART
IG_like 174 254 1.89e1 SMART
IGc2 275 337 2.58e-6 SMART
IGc2 369 425 2.16e-8 SMART
IG_like 458 523 7.29e-2 SMART
transmembrane domain 541 563 N/A INTRINSIC
low complexity region 601 619 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133271
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135632
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208280
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.7%
  • 20x: 90.1%
Validation Efficiency 100% (79/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes Lutheran blood group glycoprotein, a member of the immunoglobulin superfamily and a receptor for the extracellular matrix protein, laminin. The protein contains five extracellular immunoglobulin domains, a single transmembrane domain, and a short C-terminal cytoplasmic tail. This protein may play a role in epithelial cell cancer and in vaso-occlusion of red blood cells in sickle cell disease. Polymorphisms in this gene define some of the antigens in the Lutheran system and also the Auberger system. Inactivating variants of this gene result in the recessive Lutheran null phenotype, Lu(a-b-), of the Lutheran blood group. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2012]
PHENOTYPE: A gene trap insertion into an intron of this gene results in no obvious phenotype. Mice homozygous for a null allele exhibit glomeruli abnormalities and increased thickness and disorganization of intestinal smooth muscle. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 A T 11: 110,177,066 I1593N probably benign Het
Akr1b10 G T 6: 34,392,106 K173N probably damaging Het
Artn A T 4: 117,927,676 L3Q probably damaging Het
Asxl3 T A 18: 22,522,718 S1262T possibly damaging Het
Atp6v0a4 A T 6: 38,074,183 M420K probably benign Het
Casp2 C T 6: 42,269,272 probably benign Het
Ccdc137 A G 11: 120,462,515 probably benign Het
Cd177 C A 7: 24,744,316 A786S probably benign Het
Cdca4 T C 12: 112,821,863 N82D probably benign Het
Clu A C 14: 65,979,728 T337P probably damaging Het
Col6a3 A C 1: 90,779,352 I2013S unknown Het
Cpne9 T A 6: 113,304,488 M510K probably damaging Het
Cyp3a13 A C 5: 137,898,899 N384K possibly damaging Het
Fam186a A C 15: 99,944,646 I1239S possibly damaging Het
Fryl T C 5: 73,075,893 E413G possibly damaging Het
Fscn2 A C 11: 120,366,749 Y312S probably damaging Het
Fshr A T 17: 88,986,046 C401* probably null Het
Glyat A C 19: 12,650,263 Q74P probably damaging Het
Gm5724 A C 6: 141,767,454 M67R possibly damaging Het
Gm6158 A T 14: 24,070,090 noncoding transcript Het
Grm7 A G 6: 110,646,136 N90S probably damaging Het
Hectd1 A T 12: 51,744,879 C2536S probably damaging Het
Herc3 C T 6: 58,855,760 Q137* probably null Het
Kctd3 A C 1: 188,995,693 probably benign Het
Klhl30 A G 1: 91,355,578 T301A probably benign Het
Klra9 T C 6: 130,179,109 K228E possibly damaging Het
Lamc3 A T 2: 31,905,667 T355S possibly damaging Het
Lcmt1 A C 7: 123,410,830 probably null Het
Limch1 C T 5: 66,969,235 P60S probably damaging Het
Lrfn2 A G 17: 49,070,500 D203G probably damaging Het
Mc5r T C 18: 68,339,281 L237P probably damaging Het
Mknk2 G A 10: 80,671,769 R58W probably damaging Het
Mrgpra2b T C 7: 47,502,928 probably benign Het
Mroh2a GCCC GC 1: 88,232,257 probably null Het
Nae1 A T 8: 104,516,702 C395S possibly damaging Het
Ncoa1 A G 12: 4,259,333 M1321T probably damaging Het
Neb A C 2: 52,280,501 F1720V possibly damaging Het
Nectin2 C T 7: 19,738,273 V64I probably benign Het
Nisch T A 14: 31,172,440 T1145S probably damaging Het
Nlrp5 A T 7: 23,435,910 R1009* probably null Het
Olfr103 A T 17: 37,336,931 H100Q probably damaging Het
Olfr727 T A 14: 50,127,437 Y287N probably damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pak1ip1 A G 13: 41,008,145 probably benign Het
Pcm1 T C 8: 41,259,260 V189A probably damaging Het
Peak1 G T 9: 56,260,289 N118K probably damaging Het
Phgdh T A 3: 98,328,339 I121F probably damaging Het
Pi4ka G T 16: 17,309,397 A1064E probably benign Het
Pkhd1 A C 1: 20,585,711 C199W probably benign Het
Plat A G 8: 22,772,311 D117G probably benign Het
Ppp2r2b C A 18: 42,688,461 V211L possibly damaging Het
Ptgs1 A G 2: 36,237,282 D60G probably damaging Het
Ryr2 T C 13: 11,700,354 E2776G probably damaging Het
Sema4c C T 1: 36,552,978 probably null Het
Sharpin T C 15: 76,347,611 probably benign Het
Slamf6 A G 1: 171,936,533 I164M possibly damaging Het
Spef1 A G 2: 131,173,281 Y46H probably damaging Het
Spns1 G A 7: 126,374,329 probably benign Het
Supt5 C T 7: 28,329,015 probably null Het
Tbx5 T A 5: 119,836,922 D3E probably damaging Het
Thbs1 T C 2: 118,121,237 probably null Het
Tmem140 G A 6: 34,872,962 V138M probably damaging Het
Tmem200a T A 10: 25,993,915 D152V probably damaging Het
Tmem200b A G 4: 131,922,537 D256G probably damaging Het
Tns1 A T 1: 73,952,864 L885Q probably damaging Het
Umod G A 7: 119,472,421 Q366* probably null Het
Vsir A G 10: 60,364,263 I208V probably damaging Het
Zfp646 G A 7: 127,880,499 R616H probably damaging Het
Other mutations in Bcam
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01065:Bcam APN 7 19756799 missense probably benign 0.02
IGL01433:Bcam APN 7 19760182 missense possibly damaging 0.75
IGL01712:Bcam APN 7 19758767 missense probably damaging 0.99
IGL01943:Bcam APN 7 19765498 missense probably damaging 1.00
IGL01946:Bcam APN 7 19760117 nonsense probably null
IGL02281:Bcam APN 7 19758691 missense probably damaging 1.00
IGL02714:Bcam APN 7 19758807 splice site probably benign
IGL02837:Bcam UTSW 7 19764186 missense probably damaging 1.00
PIT4514001:Bcam UTSW 7 19764066 missense probably benign 0.06
R0063:Bcam UTSW 7 19766848 missense probably benign 0.21
R0063:Bcam UTSW 7 19766848 missense probably benign 0.21
R1500:Bcam UTSW 7 19758964 missense possibly damaging 0.75
R1575:Bcam UTSW 7 19760382 missense possibly damaging 0.87
R1585:Bcam UTSW 7 19760186 missense probably damaging 1.00
R1768:Bcam UTSW 7 19765618 missense probably null 1.00
R1813:Bcam UTSW 7 19766715 missense probably damaging 1.00
R1896:Bcam UTSW 7 19766715 missense probably damaging 1.00
R2016:Bcam UTSW 7 19760349 missense probably benign 0.38
R2117:Bcam UTSW 7 19758427 missense possibly damaging 0.71
R3713:Bcam UTSW 7 19764193 missense probably benign 0.12
R3917:Bcam UTSW 7 19765450 missense probably damaging 1.00
R4596:Bcam UTSW 7 19764157 missense probably damaging 0.97
R4866:Bcam UTSW 7 19765472 missense probably benign 0.00
R4874:Bcam UTSW 7 19769322 intron probably benign
R5054:Bcam UTSW 7 19756860 intron probably benign
R6783:Bcam UTSW 7 19766881 missense probably damaging 1.00
R6853:Bcam UTSW 7 19760406 missense probably damaging 1.00
R7016:Bcam UTSW 7 19758443 nonsense probably null
R7174:Bcam UTSW 7 19765451 missense probably damaging 1.00
R7237:Bcam UTSW 7 19769307 intron probably null
R7733:Bcam UTSW 7 19760388 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTATACCGCACATGCACACA -3'
(R):5'- CCGACCTTGAGCACTGCC -3'

Sequencing Primer
(F):5'- GCAGAGCCAGGTAGATTTCTG -3'
(R):5'- TTGAGCACTGCCCGGTC -3'
Posted On2016-06-06