Incidental Mutation 'R5062:Nlrp5'
ID 386684
Institutional Source Beutler Lab
Gene Symbol Nlrp5
Ensembl Gene ENSMUSG00000015721
Gene Name NLR family, pyrin domain containing 5
Synonyms Mater, Nalp5, Op1
MMRRC Submission 042652-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.186) question?
Stock # R5062 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 23385889-23441922 bp(+) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) A to T at 23435910 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Stop codon at position 1009 (R1009*)
Ref Sequence ENSEMBL: ENSMUSP00000104080 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015866] [ENSMUST00000086341] [ENSMUST00000108441] [ENSMUST00000133237] [ENSMUST00000139661]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000015866
AA Change: R1009*
SMART Domains Protein: ENSMUSP00000015866
Gene: ENSMUSG00000015721
AA Change: R1009*

DomainStartEndE-ValueType
Pfam:NACHT 191 359 3.5e-45 PFAM
LRR 691 718 4.51e1 SMART
LRR 747 774 1.36e-2 SMART
LRR 776 803 6.79e0 SMART
LRR 804 831 4.3e0 SMART
LRR 833 860 1.42e0 SMART
LRR 861 888 1.2e-3 SMART
LRR 890 917 1.2e2 SMART
LRR 918 945 2.2e-2 SMART
LRR 947 974 1.56e2 SMART
LRR 975 1002 3.36e-7 SMART
LRR 1004 1031 6.04e1 SMART
LRR 1032 1059 1.99e1 SMART
Predicted Effect probably null
Transcript: ENSMUST00000086341
AA Change: R993*
SMART Domains Protein: ENSMUSP00000083524
Gene: ENSMUSG00000015721
AA Change: R993*

DomainStartEndE-ValueType
Pfam:NACHT 175 343 1.5e-44 PFAM
LRR 675 702 4.51e1 SMART
LRR 731 758 1.36e-2 SMART
LRR 760 787 6.79e0 SMART
LRR 788 815 4.3e0 SMART
LRR 817 844 1.42e0 SMART
LRR 845 872 1.2e-3 SMART
LRR 874 901 1.2e2 SMART
LRR 902 929 2.2e-2 SMART
LRR 931 958 1.56e2 SMART
LRR 959 986 3.36e-7 SMART
LRR 988 1015 6.04e1 SMART
LRR 1016 1043 1.99e1 SMART
Predicted Effect probably null
Transcript: ENSMUST00000108441
AA Change: R1009*
SMART Domains Protein: ENSMUSP00000104080
Gene: ENSMUSG00000015721
AA Change: R1009*

DomainStartEndE-ValueType
Pfam:NACHT 191 359 1.5e-44 PFAM
LRR 691 718 4.51e1 SMART
LRR 747 774 1.36e-2 SMART
LRR 776 803 6.79e0 SMART
LRR 804 831 4.3e0 SMART
LRR 833 860 1.42e0 SMART
LRR 861 888 1.2e-3 SMART
LRR 890 917 1.2e2 SMART
LRR 918 945 2.2e-2 SMART
LRR 947 974 1.56e2 SMART
LRR 975 1002 3.36e-7 SMART
LRR 1004 1033 1.28e2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000133237
SMART Domains Protein: ENSMUSP00000122007
Gene: ENSMUSG00000015721

DomainStartEndE-ValueType
Pfam:NACHT 191 359 1.3e-44 PFAM
LRR 691 718 4.51e1 SMART
LRR 747 774 1.36e-2 SMART
LRR 776 803 6.79e0 SMART
LRR 804 831 4.3e0 SMART
LRR 833 860 1.42e0 SMART
LRR 861 888 1.2e-3 SMART
LRR 890 917 1.2e2 SMART
LRR 918 945 2.2e-2 SMART
LRR 947 974 1.56e2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000139661
SMART Domains Protein: ENSMUSP00000118638
Gene: ENSMUSG00000015721

DomainStartEndE-ValueType
Pfam:NACHT 191 359 1.6e-44 PFAM
Blast:LRR 691 718 8e-9 BLAST
Meta Mutation Damage Score 0.9583 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.7%
  • 20x: 90.1%
Validation Efficiency 100% (79/79)
MGI Phenotype FUNCTION: This gene encodes a member of the NACHT, leucine-rich repeat, and pyrin domain containing family. Members of this family have a pyrin domain at the N-terminus, a central NACHT domain, and a C-terminal leucine-rich repeat domain. This gene encodes a maternal-effect factor that is essential for early embryonic development in the mouse. Homozygous null mutant females are sterile, and embryos die following the first cleavage. This gene is required for endoplasmic reticulum redistribution and calcium homeostasis in oocytes. In addition, ovulated oocytes mutant for this gene have abnormal mitochondrial localization and increased mitochondrial activity, which results in mitochondrial damage and early embryonic lethality. Pseudogenes of this gene have been found on chromosomes 7 and 12. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]
PHENOTYPE: Females lacking this maternal effect gene are sterile. Preimplantation embryos do not develop past the 2-cell stage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 A T 11: 110,177,066 I1593N probably benign Het
Akr1b10 G T 6: 34,392,106 K173N probably damaging Het
Artn A T 4: 117,927,676 L3Q probably damaging Het
Asxl3 T A 18: 22,522,718 S1262T possibly damaging Het
Atp6v0a4 A T 6: 38,074,183 M420K probably benign Het
Bcam T A 7: 19,760,101 T422S possibly damaging Het
Casp2 C T 6: 42,269,272 probably benign Het
Ccdc137 A G 11: 120,462,515 probably benign Het
Cd177 C A 7: 24,744,316 A786S probably benign Het
Cdca4 T C 12: 112,821,863 N82D probably benign Het
Clu A C 14: 65,979,728 T337P probably damaging Het
Col6a3 A C 1: 90,779,352 I2013S unknown Het
Cpne9 T A 6: 113,304,488 M510K probably damaging Het
Cyp3a13 A C 5: 137,898,899 N384K possibly damaging Het
Fam186a A C 15: 99,944,646 I1239S possibly damaging Het
Fryl T C 5: 73,075,893 E413G possibly damaging Het
Fscn2 A C 11: 120,366,749 Y312S probably damaging Het
Fshr A T 17: 88,986,046 C401* probably null Het
Glyat A C 19: 12,650,263 Q74P probably damaging Het
Gm5724 A C 6: 141,767,454 M67R possibly damaging Het
Gm6158 A T 14: 24,070,090 noncoding transcript Het
Grm7 A G 6: 110,646,136 N90S probably damaging Het
Hectd1 A T 12: 51,744,879 C2536S probably damaging Het
Herc3 C T 6: 58,855,760 Q137* probably null Het
Kctd3 A C 1: 188,995,693 probably benign Het
Klhl30 A G 1: 91,355,578 T301A probably benign Het
Klra9 T C 6: 130,179,109 K228E possibly damaging Het
Lamc3 A T 2: 31,905,667 T355S possibly damaging Het
Lcmt1 A C 7: 123,410,830 probably null Het
Limch1 C T 5: 66,969,235 P60S probably damaging Het
Lrfn2 A G 17: 49,070,500 D203G probably damaging Het
Mc5r T C 18: 68,339,281 L237P probably damaging Het
Mknk2 G A 10: 80,671,769 R58W probably damaging Het
Mrgpra2b T C 7: 47,502,928 probably benign Het
Mroh2a GCCC GC 1: 88,232,257 probably null Het
Nae1 A T 8: 104,516,702 C395S possibly damaging Het
Ncoa1 A G 12: 4,259,333 M1321T probably damaging Het
Neb A C 2: 52,280,501 F1720V possibly damaging Het
Nectin2 C T 7: 19,738,273 V64I probably benign Het
Nisch T A 14: 31,172,440 T1145S probably damaging Het
Olfr103 A T 17: 37,336,931 H100Q probably damaging Het
Olfr727 T A 14: 50,127,437 Y287N probably damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pak1ip1 A G 13: 41,008,145 probably benign Het
Pcm1 T C 8: 41,259,260 V189A probably damaging Het
Peak1 G T 9: 56,260,289 N118K probably damaging Het
Phgdh T A 3: 98,328,339 I121F probably damaging Het
Pi4ka G T 16: 17,309,397 A1064E probably benign Het
Pkhd1 A C 1: 20,585,711 C199W probably benign Het
Plat A G 8: 22,772,311 D117G probably benign Het
Ppp2r2b C A 18: 42,688,461 V211L possibly damaging Het
Ptgs1 A G 2: 36,237,282 D60G probably damaging Het
Ryr2 T C 13: 11,700,354 E2776G probably damaging Het
Sema4c C T 1: 36,552,978 probably null Het
Sharpin T C 15: 76,347,611 probably benign Het
Slamf6 A G 1: 171,936,533 I164M possibly damaging Het
Spef1 A G 2: 131,173,281 Y46H probably damaging Het
Spns1 G A 7: 126,374,329 probably benign Het
Supt5 C T 7: 28,329,015 probably null Het
Tbx5 T A 5: 119,836,922 D3E probably damaging Het
Thbs1 T C 2: 118,121,237 probably null Het
Tmem140 G A 6: 34,872,962 V138M probably damaging Het
Tmem200a T A 10: 25,993,915 D152V probably damaging Het
Tmem200b A G 4: 131,922,537 D256G probably damaging Het
Tns1 A T 1: 73,952,864 L885Q probably damaging Het
Umod G A 7: 119,472,421 Q366* probably null Het
Vsir A G 10: 60,364,263 I208V probably damaging Het
Zfp646 G A 7: 127,880,499 R616H probably damaging Het
Other mutations in Nlrp5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00478:Nlrp5 APN 7 23441788 missense probably damaging 1.00
IGL01393:Nlrp5 APN 7 23404174 missense probably null 0.04
IGL01505:Nlrp5 APN 7 23417734 missense probably benign 0.15
IGL02010:Nlrp5 APN 7 23417372 missense probably benign 0.04
IGL02223:Nlrp5 APN 7 23430022 splice site probably benign
IGL02341:Nlrp5 APN 7 23404152 missense probably benign 0.43
IGL02532:Nlrp5 APN 7 23409973 missense possibly damaging 0.70
IGL02619:Nlrp5 APN 7 23424064 critical splice donor site probably null
IGL02659:Nlrp5 APN 7 23418581 missense probably damaging 1.00
IGL02828:Nlrp5 APN 7 23421460 missense possibly damaging 0.81
IGL03018:Nlrp5 APN 7 23417747 missense probably benign 0.06
IGL03164:Nlrp5 APN 7 23418373 nonsense probably null
IGL03397:Nlrp5 APN 7 23413334 missense probably damaging 1.00
IGL03404:Nlrp5 APN 7 23430034 missense probably benign 0.00
R0310:Nlrp5 UTSW 7 23430157 missense probably damaging 0.99
R0549:Nlrp5 UTSW 7 23441802 missense probably damaging 1.00
R0573:Nlrp5 UTSW 7 23417631 missense probably damaging 1.00
R0647:Nlrp5 UTSW 7 23417707 missense probably damaging 1.00
R0675:Nlrp5 UTSW 7 23417417 missense possibly damaging 0.53
R0826:Nlrp5 UTSW 7 23417708 missense probably benign 0.13
R1511:Nlrp5 UTSW 7 23413347 missense probably damaging 0.99
R1620:Nlrp5 UTSW 7 23418639 missense probably damaging 1.00
R1858:Nlrp5 UTSW 7 23418161 missense probably damaging 0.98
R1867:Nlrp5 UTSW 7 23423982 missense possibly damaging 0.85
R1887:Nlrp5 UTSW 7 23417484 missense probably damaging 1.00
R1899:Nlrp5 UTSW 7 23404797 missense probably benign 0.00
R1901:Nlrp5 UTSW 7 23423910 missense possibly damaging 0.94
R2032:Nlrp5 UTSW 7 23421512 missense probably damaging 1.00
R3083:Nlrp5 UTSW 7 23430163 missense probably benign 0.03
R3806:Nlrp5 UTSW 7 23404846 missense probably benign
R3907:Nlrp5 UTSW 7 23433646 missense possibly damaging 0.48
R4085:Nlrp5 UTSW 7 23430098 missense probably damaging 0.97
R4135:Nlrp5 UTSW 7 23418398 missense possibly damaging 0.92
R4609:Nlrp5 UTSW 7 23417748 missense probably benign 0.01
R4649:Nlrp5 UTSW 7 23418178 missense probably damaging 1.00
R4780:Nlrp5 UTSW 7 23435778 missense probably damaging 1.00
R4793:Nlrp5 UTSW 7 23417630 missense probably damaging 0.97
R5224:Nlrp5 UTSW 7 23417976 missense probably damaging 1.00
R5364:Nlrp5 UTSW 7 23418328 nonsense probably null
R5426:Nlrp5 UTSW 7 23418201 missense probably damaging 1.00
R5488:Nlrp5 UTSW 7 23417934 missense probably benign 0.03
R5762:Nlrp5 UTSW 7 23418839 missense possibly damaging 0.89
R6014:Nlrp5 UTSW 7 23409947 missense probably benign 0.02
R6130:Nlrp5 UTSW 7 23404173 missense probably benign 0.00
R6277:Nlrp5 UTSW 7 23421455 missense probably damaging 1.00
R6509:Nlrp5 UTSW 7 23417916 missense probably damaging 1.00
R6519:Nlrp5 UTSW 7 23417918 missense probably benign 0.22
R7042:Nlrp5 UTSW 7 23417480 missense possibly damaging 0.52
R7253:Nlrp5 UTSW 7 23417391 missense possibly damaging 0.93
R7336:Nlrp5 UTSW 7 23417634 missense probably damaging 0.98
R7371:Nlrp5 UTSW 7 23418423 missense probably damaging 0.99
R7449:Nlrp5 UTSW 7 23417526 missense probably benign 0.00
R7505:Nlrp5 UTSW 7 23407500 missense probably benign 0.01
R7580:Nlrp5 UTSW 7 23433749 missense probably damaging 1.00
R7588:Nlrp5 UTSW 7 23408151 missense probably benign 0.21
R7793:Nlrp5 UTSW 7 23423918 missense possibly damaging 0.87
R7795:Nlrp5 UTSW 7 23418794 missense possibly damaging 0.78
R7893:Nlrp5 UTSW 7 23418165 missense probably benign 0.12
R8071:Nlrp5 UTSW 7 23418444 missense probably damaging 1.00
R8170:Nlrp5 UTSW 7 23433710 missense probably benign 0.17
R8195:Nlrp5 UTSW 7 23413337 missense probably benign 0.00
R8212:Nlrp5 UTSW 7 23417337 missense probably benign 0.02
R8232:Nlrp5 UTSW 7 23417345 missense probably benign 0.00
R8743:Nlrp5 UTSW 7 23418747 missense probably benign 0.28
R8853:Nlrp5 UTSW 7 23418300 missense possibly damaging 0.94
R9030:Nlrp5 UTSW 7 23430148 missense possibly damaging 0.65
R9225:Nlrp5 UTSW 7 23417946 missense probably benign 0.24
R9463:Nlrp5 UTSW 7 23418800 missense probably benign 0.24
R9615:Nlrp5 UTSW 7 23408136 missense probably benign 0.10
RF007:Nlrp5 UTSW 7 23418161 missense probably benign 0.16
U24488:Nlrp5 UTSW 7 23418228 missense possibly damaging 0.94
X0026:Nlrp5 UTSW 7 23417498 nonsense probably null
X0062:Nlrp5 UTSW 7 23417990 nonsense probably null
Z1088:Nlrp5 UTSW 7 23404167 missense possibly damaging 0.82
Z1088:Nlrp5 UTSW 7 23417586 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTGCAGACTAGTGGACTGC -3'
(R):5'- GTGCTGGACCACCAAAGTATTAG -3'

Sequencing Primer
(F):5'- TGGACTGCCAACTCACACAG -3'
(R):5'- TGTATTTCCAGCACCAAGGG -3'
Posted On 2016-06-06