Mutagenetix > Incidental Mutations

Incidental Mutation 'R5062:Umod'

386688

Institutional Source

Beutler Lab

Gene Symbol

Umod

Ensembl Gene

ENSMUSG00000030963

Gene Name

uromodulin

Synonyms

uromucoid, urehr4, Urehd1, Tamm-Horsfall glycoprotein

MMRRC Submission

042652-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.116) question?

Stock #

R5062 (G1)

Quality Score

177

Status

Validated

Chromosome

Chromosomal Location

119462711-119479282 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

G to A at 119472421 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Stop codon at position 366 (Q366*)

Ref Sequence

ENSEMBL: ENSMUSP00000146652 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000033263] [ENSMUST00000207261] [ENSMUST00000207460] [ENSMUST00000209095]

Predicted Effect

probably null
Transcript: ENSMUST00000033263
AA Change: Q366*

SMART Domains

Protein: ENSMUSP00000033263
Gene: ENSMUSG00000030963
AA Change: Q366*

Domain	Start	End	E-Value	Type
EGF	31	64	4.03e-1	SMART
EGF_CA	65	106	3.81e-11	SMART
EGF_CA	107	155	4.81e-8	SMART
Blast:ZP	256	325	6e-30	BLAST
ZP	335	586	2.19e-70	SMART
low complexity region	619	634	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000207261

Predicted Effect

probably benign
Transcript: ENSMUST00000207378

Predicted Effect

probably benign
Transcript: ENSMUST00000207460

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000207729

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000208401

Predicted Effect

probably null
Transcript: ENSMUST00000209095
AA Change: Q366*

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.0%
3x: 98.2%
10x: 95.7%
20x: 90.1%

Validation Efficiency

100% (79/79)

MGI Phenotype

FUNCTION: This gene encodes a glycoprotein that is the most abundant protein in mammalian urine under physiological conditions. It is synthesized in the kidney as a glycosyl-phosphatidylinositol anchored protein and released into urine as a soluble form by proteolytic cleavage. It is thought to regulate water and salt balance in the thick ascending limb of Henle and to protect against urinary tract infection and calcium oxalate crystal formation. In mouse deficiency of this gene is associated with increased susceptibility to bacterial infections and formation of calcium crystals in kidneys. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
PHENOTYPE: Homozygous inactivation of this gene causes renal dysfunction and increased susceptibility to bladder infection, and may lead to renal calcinosis and stone formation. Homozygotes for an ENU-induced allele exhibit renal dysfunction and alterations in ureahandling, energy, bone, and lipid metabolism. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca6	A	T	11: 110,177,066	I1593N	probably benign	Het
Akr1b10	G	T	6: 34,392,106	K173N	probably damaging	Het
Artn	A	T	4: 117,927,676	L3Q	probably damaging	Het
Asxl3	T	A	18: 22,522,718	S1262T	possibly damaging	Het
Atp6v0a4	A	T	6: 38,074,183	M420K	probably benign	Het
Bcam	T	A	7: 19,760,101	T422S	possibly damaging	Het
Casp2	C	T	6: 42,269,272		probably benign	Het
Ccdc137	A	G	11: 120,462,515		probably benign	Het
Cd177	C	A	7: 24,744,316	A786S	probably benign	Het
Cdca4	T	C	12: 112,821,863	N82D	probably benign	Het
Clu	A	C	14: 65,979,728	T337P	probably damaging	Het
Col6a3	A	C	1: 90,779,352	I2013S	unknown	Het
Cpne9	T	A	6: 113,304,488	M510K	probably damaging	Het
Cyp3a13	A	C	5: 137,898,899	N384K	possibly damaging	Het
Fam186a	A	C	15: 99,944,646	I1239S	possibly damaging	Het
Fryl	T	C	5: 73,075,893	E413G	possibly damaging	Het
Fscn2	A	C	11: 120,366,749	Y312S	probably damaging	Het
Fshr	A	T	17: 88,986,046	C401*	probably null	Het
Glyat	A	C	19: 12,650,263	Q74P	probably damaging	Het
Gm5724	A	C	6: 141,767,454	M67R	possibly damaging	Het
Gm6158	A	T	14: 24,070,090		noncoding transcript	Het
Grm7	A	G	6: 110,646,136	N90S	probably damaging	Het
Hectd1	A	T	12: 51,744,879	C2536S	probably damaging	Het
Herc3	C	T	6: 58,855,760	Q137*	probably null	Het
Kctd3	A	C	1: 188,995,693		probably benign	Het
Klhl30	A	G	1: 91,355,578	T301A	probably benign	Het
Klra9	T	C	6: 130,179,109	K228E	possibly damaging	Het
Lamc3	A	T	2: 31,905,667	T355S	possibly damaging	Het
Lcmt1	A	C	7: 123,410,830		probably null	Het
Limch1	C	T	5: 66,969,235	P60S	probably damaging	Het
Lrfn2	A	G	17: 49,070,500	D203G	probably damaging	Het
Mc5r	T	C	18: 68,339,281	L237P	probably damaging	Het
Mknk2	G	A	10: 80,671,769	R58W	probably damaging	Het
Mrgpra2b	T	C	7: 47,502,928		probably benign	Het
Mroh2a	GCCC	GC	1: 88,232,257		probably null	Het
Nae1	A	T	8: 104,516,702	C395S	possibly damaging	Het
Ncoa1	A	G	12: 4,259,333	M1321T	probably damaging	Het
Neb	A	C	2: 52,280,501	F1720V	possibly damaging	Het
Nectin2	C	T	7: 19,738,273	V64I	probably benign	Het
Nisch	T	A	14: 31,172,440	T1145S	probably damaging	Het
Nlrp5	A	T	7: 23,435,910	R1009*	probably null	Het
Olfr103	A	T	17: 37,336,931	H100Q	probably damaging	Het
Olfr727	T	A	14: 50,127,437	Y287N	probably damaging	Het
Otx1	C	A	11: 21,997,037	A91S	probably damaging	Het
Pak1ip1	A	G	13: 41,008,145		probably benign	Het
Pcm1	T	C	8: 41,259,260	V189A	probably damaging	Het
Peak1	G	T	9: 56,260,289	N118K	probably damaging	Het
Phgdh	T	A	3: 98,328,339	I121F	probably damaging	Het
Pi4ka	G	T	16: 17,309,397	A1064E	probably benign	Het
Pkhd1	A	C	1: 20,585,711	C199W	probably benign	Het
Plat	A	G	8: 22,772,311	D117G	probably benign	Het
Ppp2r2b	C	A	18: 42,688,461	V211L	possibly damaging	Het
Ptgs1	A	G	2: 36,237,282	D60G	probably damaging	Het
Ryr2	T	C	13: 11,700,354	E2776G	probably damaging	Het
Sema4c	C	T	1: 36,552,978		probably null	Het
Sharpin	T	C	15: 76,347,611		probably benign	Het
Slamf6	A	G	1: 171,936,533	I164M	possibly damaging	Het
Spef1	A	G	2: 131,173,281	Y46H	probably damaging	Het
Spns1	G	A	7: 126,374,329		probably benign	Het
Supt5	C	T	7: 28,329,015		probably null	Het
Tbx5	T	A	5: 119,836,922	D3E	probably damaging	Het
Thbs1	T	C	2: 118,121,237		probably null	Het
Tmem140	G	A	6: 34,872,962	V138M	probably damaging	Het
Tmem200a	T	A	10: 25,993,915	D152V	probably damaging	Het
Tmem200b	A	G	4: 131,922,537	D256G	probably damaging	Het
Tns1	A	T	1: 73,952,864	L885Q	probably damaging	Het
Vsir	A	G	10: 60,364,263	I208V	probably damaging	Het
Zfp646	G	A	7: 127,880,499	R616H	probably damaging	Het

Other mutations in Umod

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01151:Umod	APN	7	119477219	missense	possibly damaging	0.93
IGL02527:Umod	APN	7	119469467	missense	probably damaging	1.00
R0265:Umod	UTSW	7	119466073	missense	probably benign	0.00
R1073:Umod	UTSW	7	119464741	missense	possibly damaging	0.56
R1117:Umod	UTSW	7	119477306	missense	possibly damaging	0.71
R1515:Umod	UTSW	7	119465497	missense	probably benign	0.00
R1774:Umod	UTSW	7	119477351	missense	possibly damaging	0.82
R1803:Umod	UTSW	7	119464724	missense	probably damaging	0.96
R1864:Umod	UTSW	7	119463255	missense	probably damaging	0.99
R1942:Umod	UTSW	7	119476932	missense	probably damaging	1.00
R2060:Umod	UTSW	7	119476715	missense	probably damaging	0.97
R2354:Umod	UTSW	7	119466193	missense	probably damaging	1.00
R3015:Umod	UTSW	7	119472540	missense	probably damaging	1.00
R3030:Umod	UTSW	7	119476839	missense	probably benign	0.02
R4016:Umod	UTSW	7	119476690	missense	possibly damaging	0.56
R4406:Umod	UTSW	7	119466064	missense	probably damaging	1.00
R4446:Umod	UTSW	7	119466056	splice site	probably null
R5358:Umod	UTSW	7	119472354	missense	probably damaging	1.00
R5935:Umod	UTSW	7	119471427	missense	probably damaging	1.00
R6045:Umod	UTSW	7	119476823	missense	probably benign
R6239:Umod	UTSW	7	119477297	missense	probably damaging	1.00
R7111:Umod	UTSW	7	119477146	nonsense	probably null
R7168:Umod	UTSW	7	119478326	splice site	probably benign
R7265:Umod	UTSW	7	119466073	missense	probably benign	0.00
R7273:Umod	UTSW	7	119477027	missense	probably benign	0.16

Predicted Primers

PCR Primer
(F):5'- GTCAGGTCGAACAACTCACTC -3'
(R):5'- CTTAAGCCCAGTGACCATGC -3'

Sequencing Primer
(F):5'- CTCAAAGCTCATACAAGTGGTG -3'
(R):5'- AGTGACCATGCTGTGCTC -3'

Posted On

2016-06-06