Mutagenetix > Incidental Mutation

Incidental Mutation 'R5062:Lcmt1'

386689

Institutional Source

Beutler Lab

Gene Symbol

Lcmt1

Ensembl Gene

ENSMUSG00000030763

Gene Name

leucine carboxyl methyltransferase 1

Synonyms

LCMT-1, Lcmt

MMRRC Submission

042652-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5062 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

123369784-123430358 bp(+) (GRCm38)

Type of Mutation

splice site (4 bp from exon)

DNA Base Change (assembly)

A to C at 123410830 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000145539 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000033025] [ENSMUST00000206574] [ENSMUST00000206574]

AlphaFold

A0A0U1RNF2

Predicted Effect

probably null
Transcript: ENSMUST00000033025

SMART Domains

Protein: ENSMUSP00000033025
Gene: ENSMUSG00000030763

Domain	Start	End	E-Value	Type
low complexity region	3	16	N/A	INTRINSIC
Pfam:LCM	23	215	3.6e-41	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000205880

Predicted Effect

probably null
Transcript: ENSMUST00000206574

Predicted Effect

probably null
Transcript: ENSMUST00000206574

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.0%
3x: 98.2%
10x: 95.7%
20x: 90.1%

Validation Efficiency

100% (79/79)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] LCMT1 catalyzes the methylation of the carboxyl group of the C-terminal leucine residue (leu309) of the catalytic subunit of protein phosphatase-2A (PPP2CA; MIM 176915) (De Baere et al., 1999 [PubMed 10600115]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a gene trap allele are embryonic lethal. Mice homozygous for a hypomorphic gene trap allele exhibit partial embryonic lethality, insulin resistance and impaired glucose tolerance. Mice homozygous for a transgenic gene disruption exhibit kidney agenesis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca6	A	T	11: 110,177,066	I1593N	probably benign	Het
Akr1b10	G	T	6: 34,392,106	K173N	probably damaging	Het
Artn	A	T	4: 117,927,676	L3Q	probably damaging	Het
Asxl3	T	A	18: 22,522,718	S1262T	possibly damaging	Het
Atp6v0a4	A	T	6: 38,074,183	M420K	probably benign	Het
Bcam	T	A	7: 19,760,101	T422S	possibly damaging	Het
Casp2	C	T	6: 42,269,272		probably benign	Het
Ccdc137	A	G	11: 120,462,515		probably benign	Het
Cd177	C	A	7: 24,744,316	A786S	probably benign	Het
Cdca4	T	C	12: 112,821,863	N82D	probably benign	Het
Clu	A	C	14: 65,979,728	T337P	probably damaging	Het
Col6a3	A	C	1: 90,779,352	I2013S	unknown	Het
Cpne9	T	A	6: 113,304,488	M510K	probably damaging	Het
Cyp3a13	A	C	5: 137,898,899	N384K	possibly damaging	Het
Fam186a	A	C	15: 99,944,646	I1239S	possibly damaging	Het
Fryl	T	C	5: 73,075,893	E413G	possibly damaging	Het
Fscn2	A	C	11: 120,366,749	Y312S	probably damaging	Het
Fshr	A	T	17: 88,986,046	C401*	probably null	Het
Glyat	A	C	19: 12,650,263	Q74P	probably damaging	Het
Gm5724	A	C	6: 141,767,454	M67R	possibly damaging	Het
Gm6158	A	T	14: 24,070,090		noncoding transcript	Het
Grm7	A	G	6: 110,646,136	N90S	probably damaging	Het
Hectd1	A	T	12: 51,744,879	C2536S	probably damaging	Het
Herc3	C	T	6: 58,855,760	Q137*	probably null	Het
Kctd3	A	C	1: 188,995,693		probably benign	Het
Klhl30	A	G	1: 91,355,578	T301A	probably benign	Het
Klra9	T	C	6: 130,179,109	K228E	possibly damaging	Het
Lamc3	A	T	2: 31,905,667	T355S	possibly damaging	Het
Limch1	C	T	5: 66,969,235	P60S	probably damaging	Het
Lrfn2	A	G	17: 49,070,500	D203G	probably damaging	Het
Mc5r	T	C	18: 68,339,281	L237P	probably damaging	Het
Mknk2	G	A	10: 80,671,769	R58W	probably damaging	Het
Mrgpra2b	T	C	7: 47,502,928		probably benign	Het
Mroh2a	GCCC	GC	1: 88,232,257		probably null	Het
Nae1	A	T	8: 104,516,702	C395S	possibly damaging	Het
Ncoa1	A	G	12: 4,259,333	M1321T	probably damaging	Het
Neb	A	C	2: 52,280,501	F1720V	possibly damaging	Het
Nectin2	C	T	7: 19,738,273	V64I	probably benign	Het
Nisch	T	A	14: 31,172,440	T1145S	probably damaging	Het
Nlrp5	A	T	7: 23,435,910	R1009*	probably null	Het
Olfr103	A	T	17: 37,336,931	H100Q	probably damaging	Het
Olfr727	T	A	14: 50,127,437	Y287N	probably damaging	Het
Otx1	C	A	11: 21,997,037	A91S	probably damaging	Het
Pak1ip1	A	G	13: 41,008,145		probably benign	Het
Pcm1	T	C	8: 41,259,260	V189A	probably damaging	Het
Peak1	G	T	9: 56,260,289	N118K	probably damaging	Het
Phgdh	T	A	3: 98,328,339	I121F	probably damaging	Het
Pi4ka	G	T	16: 17,309,397	A1064E	probably benign	Het
Pkhd1	A	C	1: 20,585,711	C199W	probably benign	Het
Plat	A	G	8: 22,772,311	D117G	probably benign	Het
Ppp2r2b	C	A	18: 42,688,461	V211L	possibly damaging	Het
Ptgs1	A	G	2: 36,237,282	D60G	probably damaging	Het
Ryr2	T	C	13: 11,700,354	E2776G	probably damaging	Het
Sema4c	C	T	1: 36,552,978		probably null	Het
Sharpin	T	C	15: 76,347,611		probably benign	Het
Slamf6	A	G	1: 171,936,533	I164M	possibly damaging	Het
Spef1	A	G	2: 131,173,281	Y46H	probably damaging	Het
Spns1	G	A	7: 126,374,329		probably benign	Het
Supt5	C	T	7: 28,329,015		probably null	Het
Tbx5	T	A	5: 119,836,922	D3E	probably damaging	Het
Thbs1	T	C	2: 118,121,237		probably null	Het
Tmem140	G	A	6: 34,872,962	V138M	probably damaging	Het
Tmem200a	T	A	10: 25,993,915	D152V	probably damaging	Het
Tmem200b	A	G	4: 131,922,537	D256G	probably damaging	Het
Tns1	A	T	1: 73,952,864	L885Q	probably damaging	Het
Umod	G	A	7: 119,472,421	Q366*	probably null	Het
Vsir	A	G	10: 60,364,263	I208V	probably damaging	Het
Zfp646	G	A	7: 127,880,499	R616H	probably damaging	Het

Other mutations in Lcmt1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01472:Lcmt1	APN	7	123428153	missense	probably damaging	1.00
IGL01536:Lcmt1	APN	7	123422743	missense	possibly damaging	0.46
IGL01564:Lcmt1	APN	7	123404440	missense	probably benign	0.00
IGL02598:Lcmt1	APN	7	123421648	splice site	probably benign
rancho	UTSW	7	123401495	missense	probably benign	0.03
relasso	UTSW	7	123401468	missense	probably damaging	1.00
R0665:Lcmt1	UTSW	7	123402871	missense	probably damaging	1.00
R0668:Lcmt1	UTSW	7	123402871	missense	probably damaging	1.00
R0943:Lcmt1	UTSW	7	123401439	splice site	probably null
R1574:Lcmt1	UTSW	7	123402908	missense	probably damaging	1.00
R1574:Lcmt1	UTSW	7	123402908	missense	probably damaging	1.00
R2896:Lcmt1	UTSW	7	123421586	missense	possibly damaging	0.95
R3017:Lcmt1	UTSW	7	123430136	missense	probably damaging	1.00
R3547:Lcmt1	UTSW	7	123400479	missense	probably benign	0.07
R3714:Lcmt1	UTSW	7	123404460	missense	probably damaging	0.98
R4092:Lcmt1	UTSW	7	123418253	missense	probably damaging	1.00
R4628:Lcmt1	UTSW	7	123410812	nonsense	probably null
R5096:Lcmt1	UTSW	7	123401468	missense	probably damaging	1.00
R5549:Lcmt1	UTSW	7	123428107	missense	probably damaging	1.00
R5573:Lcmt1	UTSW	7	123401463	missense	probably benign	0.03
R5931:Lcmt1	UTSW	7	123421616	missense	probably benign
R6331:Lcmt1	UTSW	7	123378182	intron	probably benign
R7752:Lcmt1	UTSW	7	123369807	missense	unknown
R7784:Lcmt1	UTSW	7	123401495	missense	probably benign	0.03
R8447:Lcmt1	UTSW	7	123421602	missense	probably damaging	1.00
R8499:Lcmt1	UTSW	7	123430148	missense	probably benign	0.02
R8743:Lcmt1	UTSW	7	123400468	missense	probably damaging	1.00
R8962:Lcmt1	UTSW	7	123401446	missense	probably damaging	1.00
R9760:Lcmt1	UTSW	7	123430152	nonsense	probably null
RF013:Lcmt1	UTSW	7	123369836	frame shift	probably null
RF025:Lcmt1	UTSW	7	123369834	frame shift	probably null
RF046:Lcmt1	UTSW	7	123369834	frame shift	probably null

Predicted Primers

PCR Primer
(F):5'- GCCATGTCCGTTAAAAGTATGATG -3'
(R):5'- TTATTATAGGCTCTCGCACACTTAC -3'

Sequencing Primer
(F):5'- CCGTTAAAAGTATGATGTCATCGGC -3'
(R):5'- GGCCAGAATTTTAAAAGGAAATCAC -3'

Posted On

2016-06-06