Incidental Mutation 'R5062:Lcmt1'
ID386689
Institutional Source Beutler Lab
Gene Symbol Lcmt1
Ensembl Gene ENSMUSG00000030763
Gene Nameleucine carboxyl methyltransferase 1
SynonymsLCMT-1, Lcmt
MMRRC Submission 042652-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5062 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location123369784-123430358 bp(+) (GRCm38)
Type of Mutationsplice site (4 bp from exon)
DNA Base Change (assembly) A to C at 123410830 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000145539 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033025] [ENSMUST00000206574] [ENSMUST00000206574]
Predicted Effect probably null
Transcript: ENSMUST00000033025
SMART Domains Protein: ENSMUSP00000033025
Gene: ENSMUSG00000030763

DomainStartEndE-ValueType
low complexity region 3 16 N/A INTRINSIC
Pfam:LCM 23 215 3.6e-41 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205880
Predicted Effect probably null
Transcript: ENSMUST00000206574
Predicted Effect probably null
Transcript: ENSMUST00000206574
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.7%
  • 20x: 90.1%
Validation Efficiency 100% (79/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] LCMT1 catalyzes the methylation of the carboxyl group of the C-terminal leucine residue (leu309) of the catalytic subunit of protein phosphatase-2A (PPP2CA; MIM 176915) (De Baere et al., 1999 [PubMed 10600115]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a gene trap allele are embryonic lethal. Mice homozygous for a hypomorphic gene trap allele exhibit partial embryonic lethality, insulin resistance and impaired glucose tolerance. Mice homozygous for a transgenic gene disruption exhibit kidney agenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 A T 11: 110,177,066 I1593N probably benign Het
Akr1b10 G T 6: 34,392,106 K173N probably damaging Het
Artn A T 4: 117,927,676 L3Q probably damaging Het
Asxl3 T A 18: 22,522,718 S1262T possibly damaging Het
Atp6v0a4 A T 6: 38,074,183 M420K probably benign Het
Bcam T A 7: 19,760,101 T422S possibly damaging Het
Casp2 C T 6: 42,269,272 probably benign Het
Ccdc137 A G 11: 120,462,515 probably benign Het
Cd177 C A 7: 24,744,316 A786S probably benign Het
Cdca4 T C 12: 112,821,863 N82D probably benign Het
Clu A C 14: 65,979,728 T337P probably damaging Het
Col6a3 A C 1: 90,779,352 I2013S unknown Het
Cpne9 T A 6: 113,304,488 M510K probably damaging Het
Cyp3a13 A C 5: 137,898,899 N384K possibly damaging Het
Fam186a A C 15: 99,944,646 I1239S possibly damaging Het
Fryl T C 5: 73,075,893 E413G possibly damaging Het
Fscn2 A C 11: 120,366,749 Y312S probably damaging Het
Fshr A T 17: 88,986,046 C401* probably null Het
Glyat A C 19: 12,650,263 Q74P probably damaging Het
Gm5724 A C 6: 141,767,454 M67R possibly damaging Het
Gm6158 A T 14: 24,070,090 noncoding transcript Het
Grm7 A G 6: 110,646,136 N90S probably damaging Het
Hectd1 A T 12: 51,744,879 C2536S probably damaging Het
Herc3 C T 6: 58,855,760 Q137* probably null Het
Kctd3 A C 1: 188,995,693 probably benign Het
Klhl30 A G 1: 91,355,578 T301A probably benign Het
Klra9 T C 6: 130,179,109 K228E possibly damaging Het
Lamc3 A T 2: 31,905,667 T355S possibly damaging Het
Limch1 C T 5: 66,969,235 P60S probably damaging Het
Lrfn2 A G 17: 49,070,500 D203G probably damaging Het
Mc5r T C 18: 68,339,281 L237P probably damaging Het
Mknk2 G A 10: 80,671,769 R58W probably damaging Het
Mrgpra2b T C 7: 47,502,928 probably benign Het
Mroh2a GCCC GC 1: 88,232,257 probably null Het
Nae1 A T 8: 104,516,702 C395S possibly damaging Het
Ncoa1 A G 12: 4,259,333 M1321T probably damaging Het
Neb A C 2: 52,280,501 F1720V possibly damaging Het
Nectin2 C T 7: 19,738,273 V64I probably benign Het
Nisch T A 14: 31,172,440 T1145S probably damaging Het
Nlrp5 A T 7: 23,435,910 R1009* probably null Het
Olfr103 A T 17: 37,336,931 H100Q probably damaging Het
Olfr727 T A 14: 50,127,437 Y287N probably damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pak1ip1 A G 13: 41,008,145 probably benign Het
Pcm1 T C 8: 41,259,260 V189A probably damaging Het
Peak1 G T 9: 56,260,289 N118K probably damaging Het
Phgdh T A 3: 98,328,339 I121F probably damaging Het
Pi4ka G T 16: 17,309,397 A1064E probably benign Het
Pkhd1 A C 1: 20,585,711 C199W probably benign Het
Plat A G 8: 22,772,311 D117G probably benign Het
Ppp2r2b C A 18: 42,688,461 V211L possibly damaging Het
Ptgs1 A G 2: 36,237,282 D60G probably damaging Het
Ryr2 T C 13: 11,700,354 E2776G probably damaging Het
Sema4c C T 1: 36,552,978 probably null Het
Sharpin T C 15: 76,347,611 probably benign Het
Slamf6 A G 1: 171,936,533 I164M possibly damaging Het
Spef1 A G 2: 131,173,281 Y46H probably damaging Het
Spns1 G A 7: 126,374,329 probably benign Het
Supt5 C T 7: 28,329,015 probably null Het
Tbx5 T A 5: 119,836,922 D3E probably damaging Het
Thbs1 T C 2: 118,121,237 probably null Het
Tmem140 G A 6: 34,872,962 V138M probably damaging Het
Tmem200a T A 10: 25,993,915 D152V probably damaging Het
Tmem200b A G 4: 131,922,537 D256G probably damaging Het
Tns1 A T 1: 73,952,864 L885Q probably damaging Het
Umod G A 7: 119,472,421 Q366* probably null Het
Vsir A G 10: 60,364,263 I208V probably damaging Het
Zfp646 G A 7: 127,880,499 R616H probably damaging Het
Other mutations in Lcmt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01472:Lcmt1 APN 7 123428153 missense probably damaging 1.00
IGL01536:Lcmt1 APN 7 123422743 missense possibly damaging 0.46
IGL01564:Lcmt1 APN 7 123404440 missense probably benign 0.00
IGL02598:Lcmt1 APN 7 123421648 splice site probably benign
R0665:Lcmt1 UTSW 7 123402871 missense probably damaging 1.00
R0668:Lcmt1 UTSW 7 123402871 missense probably damaging 1.00
R0943:Lcmt1 UTSW 7 123401439 splice site probably null
R1574:Lcmt1 UTSW 7 123402908 missense probably damaging 1.00
R1574:Lcmt1 UTSW 7 123402908 missense probably damaging 1.00
R2896:Lcmt1 UTSW 7 123421586 missense possibly damaging 0.95
R3017:Lcmt1 UTSW 7 123430136 missense probably damaging 1.00
R3547:Lcmt1 UTSW 7 123400479 missense probably benign 0.07
R3714:Lcmt1 UTSW 7 123404460 missense probably damaging 0.98
R4092:Lcmt1 UTSW 7 123418253 missense probably damaging 1.00
R4628:Lcmt1 UTSW 7 123410812 nonsense probably null
R5096:Lcmt1 UTSW 7 123401468 missense probably damaging 1.00
R5549:Lcmt1 UTSW 7 123428107 missense probably damaging 1.00
R5573:Lcmt1 UTSW 7 123401463 missense probably benign 0.03
R5931:Lcmt1 UTSW 7 123421616 missense probably benign
R6331:Lcmt1 UTSW 7 123378182 intron probably benign
R7752:Lcmt1 UTSW 7 123369807 missense unknown
R7784:Lcmt1 UTSW 7 123401495 missense probably benign 0.03
RF012:Lcmt1 UTSW 7 123369836 frame shift probably null
RF013:Lcmt1 UTSW 7 123369836 frame shift probably null
RF025:Lcmt1 UTSW 7 123369834 frame shift probably null
RF046:Lcmt1 UTSW 7 123369834 frame shift probably null
Predicted Primers PCR Primer
(F):5'- GCCATGTCCGTTAAAAGTATGATG -3'
(R):5'- TTATTATAGGCTCTCGCACACTTAC -3'

Sequencing Primer
(F):5'- CCGTTAAAAGTATGATGTCATCGGC -3'
(R):5'- GGCCAGAATTTTAAAAGGAAATCAC -3'
Posted On2016-06-06