Incidental Mutation 'R5062:Spns1'
ID386690
Institutional Source Beutler Lab
Gene Symbol Spns1
Ensembl Gene ENSMUSG00000030741
Gene Namespinster homolog 1
Synonyms2210013K02Rik
MMRRC Submission 042652-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5062 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location126370060-126377450 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) G to A at 126374329 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000145773 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032994] [ENSMUST00000032997] [ENSMUST00000119754] [ENSMUST00000119846] [ENSMUST00000138141] [ENSMUST00000150476] [ENSMUST00000205366] [ENSMUST00000205642] [ENSMUST00000205930] [ENSMUST00000206793]
Predicted Effect probably benign
Transcript: ENSMUST00000032994
SMART Domains Protein: ENSMUSP00000032994
Gene: ENSMUSG00000030741

DomainStartEndE-ValueType
low complexity region 14 34 N/A INTRINSIC
Pfam:Sugar_tr 60 250 4.6e-15 PFAM
Pfam:OATP 60 385 1.5e-9 PFAM
Pfam:MFS_1 65 435 1.8e-34 PFAM
transmembrane domain 462 484 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000032997
SMART Domains Protein: ENSMUSP00000032997
Gene: ENSMUSG00000030742

DomainStartEndE-ValueType
Pfam:LAT 1 242 4.3e-121 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000119754
SMART Domains Protein: ENSMUSP00000112555
Gene: ENSMUSG00000030741

DomainStartEndE-ValueType
low complexity region 14 34 N/A INTRINSIC
Pfam:OATP 58 147 1.2e-8 PFAM
Pfam:Sugar_tr 60 250 1.3e-14 PFAM
Pfam:MFS_1 65 430 2.4e-34 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000119846
SMART Domains Protein: ENSMUSP00000112954
Gene: ENSMUSG00000030741

DomainStartEndE-ValueType
low complexity region 14 34 N/A INTRINSIC
Pfam:OATP 58 147 1.4e-8 PFAM
Pfam:Sugar_tr 60 250 1.5e-14 PFAM
Pfam:MFS_1 65 433 2.5e-26 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126810
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137263
Predicted Effect probably benign
Transcript: ENSMUST00000138141
SMART Domains Protein: ENSMUSP00000117803
Gene: ENSMUSG00000030741

DomainStartEndE-ValueType
low complexity region 14 34 N/A INTRINSIC
Pfam:OATP 58 151 1.4e-9 PFAM
Pfam:MFS_1 65 149 1.5e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000150476
SMART Domains Protein: ENSMUSP00000115152
Gene: ENSMUSG00000030741

DomainStartEndE-ValueType
Pfam:OATP 28 120 1.3e-8 PFAM
Pfam:Sugar_tr 28 220 1.6e-15 PFAM
Pfam:MFS_1 35 237 2.4e-31 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150748
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152000
Predicted Effect probably benign
Transcript: ENSMUST00000205366
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205398
Predicted Effect probably benign
Transcript: ENSMUST00000205642
Predicted Effect probably benign
Transcript: ENSMUST00000205930
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206094
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206377
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206731
Predicted Effect probably benign
Transcript: ENSMUST00000206793
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.7%
  • 20x: 90.1%
Validation Efficiency 100% (79/79)
MGI Phenotype PHENOTYPE: Homozygous mutation results in lethality before weaning. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 A T 11: 110,177,066 I1593N probably benign Het
Akr1b10 G T 6: 34,392,106 K173N probably damaging Het
Artn A T 4: 117,927,676 L3Q probably damaging Het
Asxl3 T A 18: 22,522,718 S1262T possibly damaging Het
Atp6v0a4 A T 6: 38,074,183 M420K probably benign Het
Bcam T A 7: 19,760,101 T422S possibly damaging Het
Casp2 C T 6: 42,269,272 probably benign Het
Ccdc137 A G 11: 120,462,515 probably benign Het
Cd177 C A 7: 24,744,316 A786S probably benign Het
Cdca4 T C 12: 112,821,863 N82D probably benign Het
Clu A C 14: 65,979,728 T337P probably damaging Het
Col6a3 A C 1: 90,779,352 I2013S unknown Het
Cpne9 T A 6: 113,304,488 M510K probably damaging Het
Cyp3a13 A C 5: 137,898,899 N384K possibly damaging Het
Fam186a A C 15: 99,944,646 I1239S possibly damaging Het
Fryl T C 5: 73,075,893 E413G possibly damaging Het
Fscn2 A C 11: 120,366,749 Y312S probably damaging Het
Fshr A T 17: 88,986,046 C401* probably null Het
Glyat A C 19: 12,650,263 Q74P probably damaging Het
Gm5724 A C 6: 141,767,454 M67R possibly damaging Het
Gm6158 A T 14: 24,070,090 noncoding transcript Het
Grm7 A G 6: 110,646,136 N90S probably damaging Het
Hectd1 A T 12: 51,744,879 C2536S probably damaging Het
Herc3 C T 6: 58,855,760 Q137* probably null Het
Kctd3 A C 1: 188,995,693 probably benign Het
Klhl30 A G 1: 91,355,578 T301A probably benign Het
Klra9 T C 6: 130,179,109 K228E possibly damaging Het
Lamc3 A T 2: 31,905,667 T355S possibly damaging Het
Lcmt1 A C 7: 123,410,830 probably null Het
Limch1 C T 5: 66,969,235 P60S probably damaging Het
Lrfn2 A G 17: 49,070,500 D203G probably damaging Het
Mc5r T C 18: 68,339,281 L237P probably damaging Het
Mknk2 G A 10: 80,671,769 R58W probably damaging Het
Mrgpra2b T C 7: 47,502,928 probably benign Het
Mroh2a GCCC GC 1: 88,232,257 probably null Het
Nae1 A T 8: 104,516,702 C395S possibly damaging Het
Ncoa1 A G 12: 4,259,333 M1321T probably damaging Het
Neb A C 2: 52,280,501 F1720V possibly damaging Het
Nectin2 C T 7: 19,738,273 V64I probably benign Het
Nisch T A 14: 31,172,440 T1145S probably damaging Het
Nlrp5 A T 7: 23,435,910 R1009* probably null Het
Olfr103 A T 17: 37,336,931 H100Q probably damaging Het
Olfr727 T A 14: 50,127,437 Y287N probably damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pak1ip1 A G 13: 41,008,145 probably benign Het
Pcm1 T C 8: 41,259,260 V189A probably damaging Het
Peak1 G T 9: 56,260,289 N118K probably damaging Het
Phgdh T A 3: 98,328,339 I121F probably damaging Het
Pi4ka G T 16: 17,309,397 A1064E probably benign Het
Pkhd1 A C 1: 20,585,711 C199W probably benign Het
Plat A G 8: 22,772,311 D117G probably benign Het
Ppp2r2b C A 18: 42,688,461 V211L possibly damaging Het
Ptgs1 A G 2: 36,237,282 D60G probably damaging Het
Ryr2 T C 13: 11,700,354 E2776G probably damaging Het
Sema4c C T 1: 36,552,978 probably null Het
Sharpin T C 15: 76,347,611 probably benign Het
Slamf6 A G 1: 171,936,533 I164M possibly damaging Het
Spef1 A G 2: 131,173,281 Y46H probably damaging Het
Supt5 C T 7: 28,329,015 probably null Het
Tbx5 T A 5: 119,836,922 D3E probably damaging Het
Thbs1 T C 2: 118,121,237 probably null Het
Tmem140 G A 6: 34,872,962 V138M probably damaging Het
Tmem200a T A 10: 25,993,915 D152V probably damaging Het
Tmem200b A G 4: 131,922,537 D256G probably damaging Het
Tns1 A T 1: 73,952,864 L885Q probably damaging Het
Umod G A 7: 119,472,421 Q366* probably null Het
Vsir A G 10: 60,364,263 I208V probably damaging Het
Zfp646 G A 7: 127,880,499 R616H probably damaging Het
Other mutations in Spns1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00848:Spns1 APN 7 126371242 unclassified probably null
IGL02353:Spns1 APN 7 126375140 missense probably damaging 1.00
IGL02561:Spns1 APN 7 126373769 critical splice donor site probably null
IGL03403:Spns1 APN 7 126371536 splice site probably null
R1634:Spns1 UTSW 7 126371171 unclassified probably benign
R2327:Spns1 UTSW 7 126370786 missense probably damaging 1.00
R3552:Spns1 UTSW 7 126370371 missense possibly damaging 0.94
R3916:Spns1 UTSW 7 126371539 critical splice donor site probably null
R4025:Spns1 UTSW 7 126376946 nonsense probably null
R4095:Spns1 UTSW 7 126370786 missense probably damaging 1.00
R4656:Spns1 UTSW 7 126374302 unclassified probably benign
R4657:Spns1 UTSW 7 126374302 unclassified probably benign
R4697:Spns1 UTSW 7 126377037 missense probably damaging 1.00
R4758:Spns1 UTSW 7 126370794 missense probably damaging 1.00
R5371:Spns1 UTSW 7 126373764 unclassified probably benign
R5700:Spns1 UTSW 7 126372469 missense possibly damaging 0.95
R5973:Spns1 UTSW 7 126370323 missense probably damaging 1.00
R5985:Spns1 UTSW 7 126376730 missense probably benign 0.37
R6660:Spns1 UTSW 7 126375065 critical splice donor site probably null
R7175:Spns1 UTSW 7 126373789 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GCGCAATGGTGGAGTAACTG -3'
(R):5'- ACCGCATGTTGCAGTTTCTC -3'

Sequencing Primer
(F):5'- CAATGGTGGAGTAACTGGCCTC -3'
(R):5'- GCAGTTTCTCTGGCTAATGC -3'
Posted On2016-06-06