Incidental Mutation 'R5062:Plat'
ID386692
Institutional Source Beutler Lab
Gene Symbol Plat
Ensembl Gene ENSMUSG00000031538
Gene Nameplasminogen activator, tissue
Synonymst-PA, D8Ertd2e, tPA
MMRRC Submission 042652-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5062 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location22757727-22782844 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 22772311 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 117 (D117G)
Ref Sequence ENSEMBL: ENSMUSP00000033941 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033941]
Predicted Effect probably benign
Transcript: ENSMUST00000033941
AA Change: D117G

PolyPhen 2 Score 0.186 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000033941
Gene: ENSMUSG00000031538
AA Change: D117G

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
FN1 38 80 5.69e-15 SMART
EGF 82 117 4.92e-5 SMART
KR 122 207 3.77e-33 SMART
KR 211 296 4.39e-34 SMART
Tryp_SPc 308 553 6.59e-84 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210960
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.7%
  • 20x: 90.1%
Validation Efficiency 100% (79/79)
MGI Phenotype FUNCTION: This gene encodes a key enzyme of the fibrinolytic pathway. The encoded protein undergoes proteolytic processing by plasmin to generate a heterodimeric serine protease that cleaves the proenzyme plasminogen to produce plasmin, a protease that is required to break down fibrin clots. Additionally, the encoded protein is involved in other biological processes such as synaptic plasticity, cell migration and tissue remodeling. Mice lacking the encoded protein display a reduction in long-term potentiation in hippocampus and conversely, transgenic mice overexpressing the encoded protein have increased and prolonged long-term potentiation. [provided by RefSeq, Jul 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal behavior, CNS synpatic transmission, and response to injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 A T 11: 110,177,066 I1593N probably benign Het
Akr1b10 G T 6: 34,392,106 K173N probably damaging Het
Artn A T 4: 117,927,676 L3Q probably damaging Het
Asxl3 T A 18: 22,522,718 S1262T possibly damaging Het
Atp6v0a4 A T 6: 38,074,183 M420K probably benign Het
Bcam T A 7: 19,760,101 T422S possibly damaging Het
Casp2 C T 6: 42,269,272 probably benign Het
Ccdc137 A G 11: 120,462,515 probably benign Het
Cd177 C A 7: 24,744,316 A786S probably benign Het
Cdca4 T C 12: 112,821,863 N82D probably benign Het
Clu A C 14: 65,979,728 T337P probably damaging Het
Col6a3 A C 1: 90,779,352 I2013S unknown Het
Cpne9 T A 6: 113,304,488 M510K probably damaging Het
Cyp3a13 A C 5: 137,898,899 N384K possibly damaging Het
Fam186a A C 15: 99,944,646 I1239S possibly damaging Het
Fryl T C 5: 73,075,893 E413G possibly damaging Het
Fscn2 A C 11: 120,366,749 Y312S probably damaging Het
Fshr A T 17: 88,986,046 C401* probably null Het
Glyat A C 19: 12,650,263 Q74P probably damaging Het
Gm5724 A C 6: 141,767,454 M67R possibly damaging Het
Gm6158 A T 14: 24,070,090 noncoding transcript Het
Grm7 A G 6: 110,646,136 N90S probably damaging Het
Hectd1 A T 12: 51,744,879 C2536S probably damaging Het
Herc3 C T 6: 58,855,760 Q137* probably null Het
Kctd3 A C 1: 188,995,693 probably benign Het
Klhl30 A G 1: 91,355,578 T301A probably benign Het
Klra9 T C 6: 130,179,109 K228E possibly damaging Het
Lamc3 A T 2: 31,905,667 T355S possibly damaging Het
Lcmt1 A C 7: 123,410,830 probably null Het
Limch1 C T 5: 66,969,235 P60S probably damaging Het
Lrfn2 A G 17: 49,070,500 D203G probably damaging Het
Mc5r T C 18: 68,339,281 L237P probably damaging Het
Mknk2 G A 10: 80,671,769 R58W probably damaging Het
Mrgpra2b T C 7: 47,502,928 probably benign Het
Mroh2a GCCC GC 1: 88,232,257 probably null Het
Nae1 A T 8: 104,516,702 C395S possibly damaging Het
Ncoa1 A G 12: 4,259,333 M1321T probably damaging Het
Neb A C 2: 52,280,501 F1720V possibly damaging Het
Nectin2 C T 7: 19,738,273 V64I probably benign Het
Nisch T A 14: 31,172,440 T1145S probably damaging Het
Nlrp5 A T 7: 23,435,910 R1009* probably null Het
Olfr103 A T 17: 37,336,931 H100Q probably damaging Het
Olfr727 T A 14: 50,127,437 Y287N probably damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pak1ip1 A G 13: 41,008,145 probably benign Het
Pcm1 T C 8: 41,259,260 V189A probably damaging Het
Peak1 G T 9: 56,260,289 N118K probably damaging Het
Phgdh T A 3: 98,328,339 I121F probably damaging Het
Pi4ka G T 16: 17,309,397 A1064E probably benign Het
Pkhd1 A C 1: 20,585,711 C199W probably benign Het
Ppp2r2b C A 18: 42,688,461 V211L possibly damaging Het
Ptgs1 A G 2: 36,237,282 D60G probably damaging Het
Ryr2 T C 13: 11,700,354 E2776G probably damaging Het
Sema4c C T 1: 36,552,978 probably null Het
Sharpin T C 15: 76,347,611 probably benign Het
Slamf6 A G 1: 171,936,533 I164M possibly damaging Het
Spef1 A G 2: 131,173,281 Y46H probably damaging Het
Spns1 G A 7: 126,374,329 probably benign Het
Supt5 C T 7: 28,329,015 probably null Het
Tbx5 T A 5: 119,836,922 D3E probably damaging Het
Thbs1 T C 2: 118,121,237 probably null Het
Tmem140 G A 6: 34,872,962 V138M probably damaging Het
Tmem200a T A 10: 25,993,915 D152V probably damaging Het
Tmem200b A G 4: 131,922,537 D256G probably damaging Het
Tns1 A T 1: 73,952,864 L885Q probably damaging Het
Umod G A 7: 119,472,421 Q366* probably null Het
Vsir A G 10: 60,364,263 I208V probably damaging Het
Zfp646 G A 7: 127,880,499 R616H probably damaging Het
Other mutations in Plat
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01457:Plat APN 8 22776828 missense probably benign 0.00
IGL01918:Plat APN 8 22780437 missense possibly damaging 0.82
IGL01998:Plat APN 8 22767147 missense probably benign 0.31
IGL02978:Plat APN 8 22776819 missense probably damaging 1.00
R0829:Plat UTSW 8 22772257 missense probably damaging 1.00
R1065:Plat UTSW 8 22776863 missense probably damaging 0.99
R2316:Plat UTSW 8 22776865 missense probably benign 0.04
R4485:Plat UTSW 8 22772212 missense probably benign 0.01
R4873:Plat UTSW 8 22768450 missense probably benign 0.03
R4875:Plat UTSW 8 22768450 missense probably benign 0.03
R4924:Plat UTSW 8 22778253 missense probably damaging 1.00
R5051:Plat UTSW 8 22773672 missense probably benign 0.01
R5402:Plat UTSW 8 22772722 missense probably damaging 1.00
R5672:Plat UTSW 8 22773648 missense probably benign 0.40
R6306:Plat UTSW 8 22772266 missense possibly damaging 0.83
R7035:Plat UTSW 8 22772311 missense probably benign 0.32
R7154:Plat UTSW 8 22778505 missense possibly damaging 0.76
R7297:Plat UTSW 8 22775697 missense probably benign 0.12
R7432:Plat UTSW 8 22773651 missense probably damaging 0.99
R7514:Plat UTSW 8 22775642 missense probably damaging 1.00
R7679:Plat UTSW 8 22772232 missense probably damaging 1.00
R7680:Plat UTSW 8 22772232 missense probably damaging 1.00
R7742:Plat UTSW 8 22772232 missense probably damaging 1.00
R7834:Plat UTSW 8 22772232 missense probably damaging 1.00
R7885:Plat UTSW 8 22771720 missense probably benign 0.00
R7917:Plat UTSW 8 22772232 missense probably damaging 1.00
R7968:Plat UTSW 8 22771720 missense probably benign 0.00
R8039:Plat UTSW 8 22772232 missense probably damaging 1.00
R8040:Plat UTSW 8 22772232 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGGAATGGAGGCTGACATC -3'
(R):5'- GACTCTGGATTGTCACTTCAGG -3'

Sequencing Primer
(F):5'- GAGGCTGACATCTAAAACGCTTTGAC -3'
(R):5'- GGATTGTCACTTCAGGCTCTGAC -3'
Posted On2016-06-06