Mutagenetix > Incidental Mutation

Incidental Mutation 'R5062:Plat'

386692

Institutional Source

Beutler Lab

Gene Symbol

Plat

Ensembl Gene

ENSMUSG00000031538

Gene Name

plasminogen activator, tissue

Synonyms

t-PA, D8Ertd2e, tPA

MMRRC Submission

042652-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5062 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

22757727-22782844 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 22772311 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 117 (D117G)

Ref Sequence

ENSEMBL: ENSMUSP00000033941 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000033941]

AlphaFold

P11214

Predicted Effect

probably benign
Transcript: ENSMUST00000033941
AA Change: D117G

PolyPhen 2 Score 0.186 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000033941
Gene: ENSMUSG00000031538
AA Change: D117G

Domain	Start	End	E-Value	Type
signal peptide	1	17	N/A	INTRINSIC
FN1	38	80	5.69e-15	SMART
EGF	82	117	4.92e-5	SMART
KR	122	207	3.77e-33	SMART
KR	211	296	4.39e-34	SMART
Tryp_SPc	308	553	6.59e-84	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000210960

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.0%
3x: 98.2%
10x: 95.7%
20x: 90.1%

Validation Efficiency

100% (79/79)

MGI Phenotype

FUNCTION: This gene encodes a key enzyme of the fibrinolytic pathway. The encoded protein undergoes proteolytic processing by plasmin to generate a heterodimeric serine protease that cleaves the proenzyme plasminogen to produce plasmin, a protease that is required to break down fibrin clots. Additionally, the encoded protein is involved in other biological processes such as synaptic plasticity, cell migration and tissue remodeling. Mice lacking the encoded protein display a reduction in long-term potentiation in hippocampus and conversely, transgenic mice overexpressing the encoded protein have increased and prolonged long-term potentiation. [provided by RefSeq, Jul 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal behavior, CNS synpatic transmission, and response to injury. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca6	A	T	11: 110,177,066	I1593N	probably benign	Het
Akr1b10	G	T	6: 34,392,106	K173N	probably damaging	Het
Artn	A	T	4: 117,927,676	L3Q	probably damaging	Het
Asxl3	T	A	18: 22,522,718	S1262T	possibly damaging	Het
Atp6v0a4	A	T	6: 38,074,183	M420K	probably benign	Het
Bcam	T	A	7: 19,760,101	T422S	possibly damaging	Het
Casp2	C	T	6: 42,269,272		probably benign	Het
Ccdc137	A	G	11: 120,462,515		probably benign	Het
Cd177	C	A	7: 24,744,316	A786S	probably benign	Het
Cdca4	T	C	12: 112,821,863	N82D	probably benign	Het
Clu	A	C	14: 65,979,728	T337P	probably damaging	Het
Col6a3	A	C	1: 90,779,352	I2013S	unknown	Het
Cpne9	T	A	6: 113,304,488	M510K	probably damaging	Het
Cyp3a13	A	C	5: 137,898,899	N384K	possibly damaging	Het
Fam186a	A	C	15: 99,944,646	I1239S	possibly damaging	Het
Fryl	T	C	5: 73,075,893	E413G	possibly damaging	Het
Fscn2	A	C	11: 120,366,749	Y312S	probably damaging	Het
Fshr	A	T	17: 88,986,046	C401*	probably null	Het
Glyat	A	C	19: 12,650,263	Q74P	probably damaging	Het
Gm5724	A	C	6: 141,767,454	M67R	possibly damaging	Het
Gm6158	A	T	14: 24,070,090		noncoding transcript	Het
Grm7	A	G	6: 110,646,136	N90S	probably damaging	Het
Hectd1	A	T	12: 51,744,879	C2536S	probably damaging	Het
Herc3	C	T	6: 58,855,760	Q137*	probably null	Het
Kctd3	A	C	1: 188,995,693		probably benign	Het
Klhl30	A	G	1: 91,355,578	T301A	probably benign	Het
Klra9	T	C	6: 130,179,109	K228E	possibly damaging	Het
Lamc3	A	T	2: 31,905,667	T355S	possibly damaging	Het
Lcmt1	A	C	7: 123,410,830		probably null	Het
Limch1	C	T	5: 66,969,235	P60S	probably damaging	Het
Lrfn2	A	G	17: 49,070,500	D203G	probably damaging	Het
Mc5r	T	C	18: 68,339,281	L237P	probably damaging	Het
Mknk2	G	A	10: 80,671,769	R58W	probably damaging	Het
Mrgpra2b	T	C	7: 47,502,928		probably benign	Het
Mroh2a	GCCC	GC	1: 88,232,257		probably null	Het
Nae1	A	T	8: 104,516,702	C395S	possibly damaging	Het
Ncoa1	A	G	12: 4,259,333	M1321T	probably damaging	Het
Neb	A	C	2: 52,280,501	F1720V	possibly damaging	Het
Nectin2	C	T	7: 19,738,273	V64I	probably benign	Het
Nisch	T	A	14: 31,172,440	T1145S	probably damaging	Het
Nlrp5	A	T	7: 23,435,910	R1009*	probably null	Het
Olfr103	A	T	17: 37,336,931	H100Q	probably damaging	Het
Olfr727	T	A	14: 50,127,437	Y287N	probably damaging	Het
Otx1	C	A	11: 21,997,037	A91S	probably damaging	Het
Pak1ip1	A	G	13: 41,008,145		probably benign	Het
Pcm1	T	C	8: 41,259,260	V189A	probably damaging	Het
Peak1	G	T	9: 56,260,289	N118K	probably damaging	Het
Phgdh	T	A	3: 98,328,339	I121F	probably damaging	Het
Pi4ka	G	T	16: 17,309,397	A1064E	probably benign	Het
Pkhd1	A	C	1: 20,585,711	C199W	probably benign	Het
Ppp2r2b	C	A	18: 42,688,461	V211L	possibly damaging	Het
Ptgs1	A	G	2: 36,237,282	D60G	probably damaging	Het
Ryr2	T	C	13: 11,700,354	E2776G	probably damaging	Het
Sema4c	C	T	1: 36,552,978		probably null	Het
Sharpin	T	C	15: 76,347,611		probably benign	Het
Slamf6	A	G	1: 171,936,533	I164M	possibly damaging	Het
Spef1	A	G	2: 131,173,281	Y46H	probably damaging	Het
Spns1	G	A	7: 126,374,329		probably benign	Het
Supt5	C	T	7: 28,329,015		probably null	Het
Tbx5	T	A	5: 119,836,922	D3E	probably damaging	Het
Thbs1	T	C	2: 118,121,237		probably null	Het
Tmem140	G	A	6: 34,872,962	V138M	probably damaging	Het
Tmem200a	T	A	10: 25,993,915	D152V	probably damaging	Het
Tmem200b	A	G	4: 131,922,537	D256G	probably damaging	Het
Tns1	A	T	1: 73,952,864	L885Q	probably damaging	Het
Umod	G	A	7: 119,472,421	Q366*	probably null	Het
Vsir	A	G	10: 60,364,263	I208V	probably damaging	Het
Zfp646	G	A	7: 127,880,499	R616H	probably damaging	Het

Other mutations in Plat

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01457:Plat	APN	8	22776828	missense	probably benign	0.00
IGL01918:Plat	APN	8	22780437	missense	possibly damaging	0.82
IGL01998:Plat	APN	8	22767147	missense	probably benign	0.31
IGL02978:Plat	APN	8	22776819	missense	probably damaging	1.00
R0829:Plat	UTSW	8	22772257	missense	probably damaging	1.00
R1065:Plat	UTSW	8	22776863	missense	probably damaging	0.99
R2316:Plat	UTSW	8	22776865	missense	probably benign	0.04
R4485:Plat	UTSW	8	22772212	missense	probably benign	0.01
R4873:Plat	UTSW	8	22768450	missense	probably benign	0.03
R4875:Plat	UTSW	8	22768450	missense	probably benign	0.03
R4924:Plat	UTSW	8	22778253	missense	probably damaging	1.00
R5051:Plat	UTSW	8	22773672	missense	probably benign	0.01
R5402:Plat	UTSW	8	22772722	missense	probably damaging	1.00
R5672:Plat	UTSW	8	22773648	missense	probably benign	0.40
R6306:Plat	UTSW	8	22772266	missense	possibly damaging	0.83
R7035:Plat	UTSW	8	22772311	missense	probably benign	0.32
R7154:Plat	UTSW	8	22778505	missense	possibly damaging	0.76
R7297:Plat	UTSW	8	22775697	missense	probably benign	0.12
R7432:Plat	UTSW	8	22773651	missense	probably damaging	0.99
R7514:Plat	UTSW	8	22775642	missense	probably damaging	1.00
R7679:Plat	UTSW	8	22772232	missense	probably damaging	1.00
R7680:Plat	UTSW	8	22772232	missense	probably damaging	1.00
R7742:Plat	UTSW	8	22772232	missense	probably damaging	1.00
R7834:Plat	UTSW	8	22772232	missense	probably damaging	1.00
R7885:Plat	UTSW	8	22771720	missense	probably benign	0.00
R7918:Plat	UTSW	8	22773639	missense	probably damaging	1.00
R8039:Plat	UTSW	8	22772232	missense	probably damaging	1.00
R8040:Plat	UTSW	8	22772232	missense	probably damaging	1.00
R8243:Plat	UTSW	8	22772232	missense	probably damaging	1.00
R8347:Plat	UTSW	8	22772232	missense	probably damaging	1.00
R8355:Plat	UTSW	8	22771742	nonsense	probably null
R8422:Plat	UTSW	8	22772232	missense	probably damaging	1.00
R8423:Plat	UTSW	8	22772232	missense	probably damaging	1.00
R8424:Plat	UTSW	8	22772232	missense	probably damaging	1.00
R8426:Plat	UTSW	8	22772232	missense	probably damaging	1.00
R8427:Plat	UTSW	8	22772232	missense	probably damaging	1.00
R8485:Plat	UTSW	8	22772232	missense	probably damaging	1.00
R8507:Plat	UTSW	8	22772232	missense	probably damaging	1.00
R8510:Plat	UTSW	8	22772232	missense	probably damaging	1.00
R8714:Plat	UTSW	8	22772232	missense	probably damaging	1.00
R8716:Plat	UTSW	8	22772232	missense	probably damaging	1.00
R8717:Plat	UTSW	8	22772232	missense	probably damaging	1.00
R9140:Plat	UTSW	8	22780546	missense	probably damaging	1.00
R9148:Plat	UTSW	8	22778450	missense	probably damaging	0.99
R9289:Plat	UTSW	8	22782084	missense	probably damaging	1.00
R9328:Plat	UTSW	8	22778117	missense	probably damaging	1.00
R9378:Plat	UTSW	8	22775583	missense	probably damaging	1.00
R9557:Plat	UTSW	8	22772653	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- GTGGAATGGAGGCTGACATC -3'
(R):5'- GACTCTGGATTGTCACTTCAGG -3'

Sequencing Primer
(F):5'- GAGGCTGACATCTAAAACGCTTTGAC -3'
(R):5'- GGATTGTCACTTCAGGCTCTGAC -3'

Posted On

2016-06-06