Incidental Mutation 'R5062:Mknk2'
ID 386699
Institutional Source Beutler Lab
Gene Symbol Mknk2
Ensembl Gene ENSMUSG00000020190
Gene Name MAP kinase-interacting serine/threonine kinase 2
Synonyms Mnk2
MMRRC Submission 042652-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R5062 (G1)
Quality Score 225
Status Validated
Chromosome 10
Chromosomal Location 80665327-80678112 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 80671769 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Tryptophan at position 58 (R58W)
Ref Sequence ENSEMBL: ENSMUSP00000143679 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003433] [ENSMUST00000197276] [ENSMUST00000198819] [ENSMUST00000199949] [ENSMUST00000200082]
AlphaFold Q8CDB0
Predicted Effect probably damaging
Transcript: ENSMUST00000003433
AA Change: R23W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000003433
Gene: ENSMUSG00000020190
AA Change: R23W

DomainStartEndE-ValueType
low complexity region 13 23 N/A INTRINSIC
S_TKc 36 321 7.09e-88 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000197276
AA Change: R58W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143679
Gene: ENSMUSG00000020190
AA Change: R58W

DomainStartEndE-ValueType
SCOP:d1koba_ 52 118 3e-11 SMART
PDB:2AC3|A 59 118 3e-32 PDB
Blast:S_TKc 71 118 1e-24 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000198819
AA Change: R23W

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably benign
Transcript: ENSMUST00000199949
Predicted Effect probably damaging
Transcript: ENSMUST00000200082
AA Change: R70W

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000143508
Gene: ENSMUSG00000020190
AA Change: R70W

DomainStartEndE-ValueType
low complexity region 60 70 N/A INTRINSIC
S_TKc 83 368 7.09e-88 SMART
Meta Mutation Damage Score 0.2024 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.7%
  • 20x: 90.1%
Validation Efficiency 100% (79/79)
MGI Phenotype FUNCTION: The protein encoded by this gene is a serine/threonine-protein kinase, which is targeted by both the extracellular signal-regulated kinase and p38 mitogen-activated protein kinase pathways. This enzyme targets several substrates including eukaryotic translation initiation factor 4E and mammalian target of rapamycin, which are negatively regulated by its phosphorylation. Null mutant mice do not exhibit developmental or reproductive defects. However, mice null for both this protein and mitogen-activated protein kinase-interacting serine/threonine protein kinase 1 have delayed tumor development in phosphatase and tensin homolog mutant mice, indicating an oncogenic function for this gene in tumor development. [provided by RefSeq, Oct 2014]
PHENOTYPE: Homozygous null mice are viable and fertile with no gross abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 A T 11: 110,177,066 I1593N probably benign Het
Akr1b10 G T 6: 34,392,106 K173N probably damaging Het
Artn A T 4: 117,927,676 L3Q probably damaging Het
Asxl3 T A 18: 22,522,718 S1262T possibly damaging Het
Atp6v0a4 A T 6: 38,074,183 M420K probably benign Het
Bcam T A 7: 19,760,101 T422S possibly damaging Het
Casp2 C T 6: 42,269,272 probably benign Het
Ccdc137 A G 11: 120,462,515 probably benign Het
Cd177 C A 7: 24,744,316 A786S probably benign Het
Cdca4 T C 12: 112,821,863 N82D probably benign Het
Clu A C 14: 65,979,728 T337P probably damaging Het
Col6a3 A C 1: 90,779,352 I2013S unknown Het
Cpne9 T A 6: 113,304,488 M510K probably damaging Het
Cyp3a13 A C 5: 137,898,899 N384K possibly damaging Het
Fam186a A C 15: 99,944,646 I1239S possibly damaging Het
Fryl T C 5: 73,075,893 E413G possibly damaging Het
Fscn2 A C 11: 120,366,749 Y312S probably damaging Het
Fshr A T 17: 88,986,046 C401* probably null Het
Glyat A C 19: 12,650,263 Q74P probably damaging Het
Gm5724 A C 6: 141,767,454 M67R possibly damaging Het
Gm6158 A T 14: 24,070,090 noncoding transcript Het
Grm7 A G 6: 110,646,136 N90S probably damaging Het
Hectd1 A T 12: 51,744,879 C2536S probably damaging Het
Herc3 C T 6: 58,855,760 Q137* probably null Het
Kctd3 A C 1: 188,995,693 probably benign Het
Klhl30 A G 1: 91,355,578 T301A probably benign Het
Klra9 T C 6: 130,179,109 K228E possibly damaging Het
Lamc3 A T 2: 31,905,667 T355S possibly damaging Het
Lcmt1 A C 7: 123,410,830 probably null Het
Limch1 C T 5: 66,969,235 P60S probably damaging Het
Lrfn2 A G 17: 49,070,500 D203G probably damaging Het
Mc5r T C 18: 68,339,281 L237P probably damaging Het
Mrgpra2b T C 7: 47,502,928 probably benign Het
Mroh2a GCCC GC 1: 88,232,257 probably null Het
Nae1 A T 8: 104,516,702 C395S possibly damaging Het
Ncoa1 A G 12: 4,259,333 M1321T probably damaging Het
Neb A C 2: 52,280,501 F1720V possibly damaging Het
Nectin2 C T 7: 19,738,273 V64I probably benign Het
Nisch T A 14: 31,172,440 T1145S probably damaging Het
Nlrp5 A T 7: 23,435,910 R1009* probably null Het
Olfr103 A T 17: 37,336,931 H100Q probably damaging Het
Olfr727 T A 14: 50,127,437 Y287N probably damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pak1ip1 A G 13: 41,008,145 probably benign Het
Pcm1 T C 8: 41,259,260 V189A probably damaging Het
Peak1 G T 9: 56,260,289 N118K probably damaging Het
Phgdh T A 3: 98,328,339 I121F probably damaging Het
Pi4ka G T 16: 17,309,397 A1064E probably benign Het
Pkhd1 A C 1: 20,585,711 C199W probably benign Het
Plat A G 8: 22,772,311 D117G probably benign Het
Ppp2r2b C A 18: 42,688,461 V211L possibly damaging Het
Ptgs1 A G 2: 36,237,282 D60G probably damaging Het
Ryr2 T C 13: 11,700,354 E2776G probably damaging Het
Sema4c C T 1: 36,552,978 probably null Het
Sharpin T C 15: 76,347,611 probably benign Het
Slamf6 A G 1: 171,936,533 I164M possibly damaging Het
Spef1 A G 2: 131,173,281 Y46H probably damaging Het
Spns1 G A 7: 126,374,329 probably benign Het
Supt5 C T 7: 28,329,015 probably null Het
Tbx5 T A 5: 119,836,922 D3E probably damaging Het
Thbs1 T C 2: 118,121,237 probably null Het
Tmem140 G A 6: 34,872,962 V138M probably damaging Het
Tmem200a T A 10: 25,993,915 D152V probably damaging Het
Tmem200b A G 4: 131,922,537 D256G probably damaging Het
Tns1 A T 1: 73,952,864 L885Q probably damaging Het
Umod G A 7: 119,472,421 Q366* probably null Het
Vsir A G 10: 60,364,263 I208V probably damaging Het
Zfp646 G A 7: 127,880,499 R616H probably damaging Het
Other mutations in Mknk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01468:Mknk2 APN 10 80667664 splice site probably benign
IGL02471:Mknk2 APN 10 80668121 missense probably damaging 0.99
IGL02643:Mknk2 APN 10 80668601 missense probably damaging 1.00
H8562:Mknk2 UTSW 10 80668934 splice site probably benign
IGL03052:Mknk2 UTSW 10 80669662 missense probably benign 0.12
R0645:Mknk2 UTSW 10 80671908 splice site probably null
R2061:Mknk2 UTSW 10 80671557 critical splice donor site probably null
R2105:Mknk2 UTSW 10 80668601 missense possibly damaging 0.90
R2167:Mknk2 UTSW 10 80668701 missense probably damaging 1.00
R3847:Mknk2 UTSW 10 80667975 nonsense probably null
R4649:Mknk2 UTSW 10 80669339 missense probably damaging 1.00
R5358:Mknk2 UTSW 10 80671763 missense probably benign 0.19
R5433:Mknk2 UTSW 10 80667225 missense probably benign 0.00
R5518:Mknk2 UTSW 10 80668641 missense possibly damaging 0.92
R5813:Mknk2 UTSW 10 80675862 missense probably benign 0.34
R6060:Mknk2 UTSW 10 80671634 missense probably benign 0.00
R6151:Mknk2 UTSW 10 80669025 splice site probably null
R6366:Mknk2 UTSW 10 80671933 missense probably damaging 0.99
R7640:Mknk2 UTSW 10 80668566 missense probably benign 0.00
R7827:Mknk2 UTSW 10 80667187 missense probably benign 0.03
R7943:Mknk2 UTSW 10 80675867 missense probably benign 0.00
R8075:Mknk2 UTSW 10 80672148 intron probably benign
R9114:Mknk2 UTSW 10 80668989 missense probably damaging 1.00
R9140:Mknk2 UTSW 10 80671593 missense probably benign 0.22
R9451:Mknk2 UTSW 10 80669662 missense probably benign 0.12
R9506:Mknk2 UTSW 10 80668084 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTGACAGCATATTCCTGGTTGG -3'
(R):5'- TGACTTCAGCCCACAGTGTG -3'

Sequencing Primer
(F):5'- TGAGATTGACACAGGTCTGCAC -3'
(R):5'- ACAGTGTGAAGCCCGACCTG -3'
Posted On 2016-06-06