Mutagenetix > Incidental Mutations

Incidental Mutation 'R5062:Ncoa1'

386704

Institutional Source

Beutler Lab

Gene Symbol

Ncoa1

Ensembl Gene

ENSMUSG00000020647

Gene Name

nuclear receptor coactivator 1

Synonyms

bHLHe74, SRC-a/NCoA-1, KAT13A, SRC-1, SRC1, steroid receptor coactivator-1

MMRRC Submission

042652-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5062 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

4247362-4477182 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 4259333 bp

Zygosity

Heterozygous

Amino Acid Change

Methionine to Threonine at position 1321 (M1321T)

Ref Sequence

ENSEMBL: ENSMUSP00000151358 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000085814] [ENSMUST00000217794] [ENSMUST00000220434]

Predicted Effect

probably damaging
Transcript: ENSMUST00000085814
AA Change: M1321T

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000082971
Gene: ENSMUSG00000020647
AA Change: M1321T

Domain	Start	End	E-Value	Type
HLH	29	86	1.73e-9	SMART
PAS	111	178	1.32e-10	SMART
Pfam:PAS_11	259	370	8e-37	PFAM
low complexity region	419	441	N/A	INTRINSIC
Pfam:NCOA_u2	468	591	1.3e-29	PFAM
Pfam:SRC-1	632	712	3.5e-26	PFAM
low complexity region	724	736	N/A	INTRINSIC
PDB:3RVF\|B	747	767	1e-6	PDB
low complexity region	777	785	N/A	INTRINSIC
low complexity region	869	880	N/A	INTRINSIC
Pfam:Nuc_rec_co-act	930	977	2.3e-23	PFAM
low complexity region	1059	1080	N/A	INTRINSIC
low complexity region	1125	1137	N/A	INTRINSIC
DUF1518	1155	1211	7.47e-16	SMART
DUF1518	1218	1274	1.14e-11	SMART
low complexity region	1303	1315	N/A	INTRINSIC
low complexity region	1333	1354	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000217794

Predicted Effect

unknown
Transcript: ENSMUST00000218191
AA Change: M332T

Predicted Effect

unknown
Transcript: ENSMUST00000219373
AA Change: M69T

Predicted Effect

probably damaging
Transcript: ENSMUST00000220434
AA Change: M1321T

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)

Meta Mutation Damage Score

0.8571

Coding Region Coverage

1x: 99.0%
3x: 98.2%
10x: 95.7%
20x: 90.1%

Validation Efficiency

100% (79/79)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene acts as a transcriptional coactivator for steroid and nuclear hormone receptors. It is a member of the p160/steroid receptor coactivator (SRC) family and like other family members has histone acetyltransferase activity and contains a nuclear localization signal, as well as bHLH and PAS domains. The product of this gene binds nuclear receptors directly and stimulates the transcriptional activities in a hormone-dependent fashion. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a null allele show osteopenia, increased serum sex hormone levels, altered bone remodeling and skeletal responses to sex hormones, and obesity. Homozygotes for another null allele show thyroid and steroid hormone resistance, delayed Purkinje cell development, and behavioral deficits. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca6	A	T	11: 110,177,066	I1593N	probably benign	Het
Akr1b10	G	T	6: 34,392,106	K173N	probably damaging	Het
Artn	A	T	4: 117,927,676	L3Q	probably damaging	Het
Asxl3	T	A	18: 22,522,718	S1262T	possibly damaging	Het
Atp6v0a4	A	T	6: 38,074,183	M420K	probably benign	Het
Bcam	T	A	7: 19,760,101	T422S	possibly damaging	Het
Casp2	C	T	6: 42,269,272		probably benign	Het
Ccdc137	A	G	11: 120,462,515		probably benign	Het
Cd177	C	A	7: 24,744,316	A786S	probably benign	Het
Cdca4	T	C	12: 112,821,863	N82D	probably benign	Het
Clu	A	C	14: 65,979,728	T337P	probably damaging	Het
Col6a3	A	C	1: 90,779,352	I2013S	unknown	Het
Cpne9	T	A	6: 113,304,488	M510K	probably damaging	Het
Cyp3a13	A	C	5: 137,898,899	N384K	possibly damaging	Het
Fam186a	A	C	15: 99,944,646	I1239S	possibly damaging	Het
Fryl	T	C	5: 73,075,893	E413G	possibly damaging	Het
Fscn2	A	C	11: 120,366,749	Y312S	probably damaging	Het
Fshr	A	T	17: 88,986,046	C401*	probably null	Het
Glyat	A	C	19: 12,650,263	Q74P	probably damaging	Het
Gm5724	A	C	6: 141,767,454	M67R	possibly damaging	Het
Gm6158	A	T	14: 24,070,090		noncoding transcript	Het
Grm7	A	G	6: 110,646,136	N90S	probably damaging	Het
Hectd1	A	T	12: 51,744,879	C2536S	probably damaging	Het
Herc3	C	T	6: 58,855,760	Q137*	probably null	Het
Kctd3	A	C	1: 188,995,693		probably benign	Het
Klhl30	A	G	1: 91,355,578	T301A	probably benign	Het
Klra9	T	C	6: 130,179,109	K228E	possibly damaging	Het
Lamc3	A	T	2: 31,905,667	T355S	possibly damaging	Het
Lcmt1	A	C	7: 123,410,830		probably null	Het
Limch1	C	T	5: 66,969,235	P60S	probably damaging	Het
Lrfn2	A	G	17: 49,070,500	D203G	probably damaging	Het
Mc5r	T	C	18: 68,339,281	L237P	probably damaging	Het
Mknk2	G	A	10: 80,671,769	R58W	probably damaging	Het
Mrgpra2b	T	C	7: 47,502,928		probably benign	Het
Mroh2a	GCCC	GC	1: 88,232,257		probably null	Het
Nae1	A	T	8: 104,516,702	C395S	possibly damaging	Het
Neb	A	C	2: 52,280,501	F1720V	possibly damaging	Het
Nectin2	C	T	7: 19,738,273	V64I	probably benign	Het
Nisch	T	A	14: 31,172,440	T1145S	probably damaging	Het
Nlrp5	A	T	7: 23,435,910	R1009*	probably null	Het
Olfr103	A	T	17: 37,336,931	H100Q	probably damaging	Het
Olfr727	T	A	14: 50,127,437	Y287N	probably damaging	Het
Otx1	C	A	11: 21,997,037	A91S	probably damaging	Het
Pak1ip1	A	G	13: 41,008,145		probably benign	Het
Pcm1	T	C	8: 41,259,260	V189A	probably damaging	Het
Peak1	G	T	9: 56,260,289	N118K	probably damaging	Het
Phgdh	T	A	3: 98,328,339	I121F	probably damaging	Het
Pi4ka	G	T	16: 17,309,397	A1064E	probably benign	Het
Pkhd1	A	C	1: 20,585,711	C199W	probably benign	Het
Plat	A	G	8: 22,772,311	D117G	probably benign	Het
Ppp2r2b	C	A	18: 42,688,461	V211L	possibly damaging	Het
Ptgs1	A	G	2: 36,237,282	D60G	probably damaging	Het
Ryr2	T	C	13: 11,700,354	E2776G	probably damaging	Het
Sema4c	C	T	1: 36,552,978		probably null	Het
Sharpin	T	C	15: 76,347,611		probably benign	Het
Slamf6	A	G	1: 171,936,533	I164M	possibly damaging	Het
Spef1	A	G	2: 131,173,281	Y46H	probably damaging	Het
Spns1	G	A	7: 126,374,329		probably benign	Het
Supt5	C	T	7: 28,329,015		probably null	Het
Tbx5	T	A	5: 119,836,922	D3E	probably damaging	Het
Thbs1	T	C	2: 118,121,237		probably null	Het
Tmem140	G	A	6: 34,872,962	V138M	probably damaging	Het
Tmem200a	T	A	10: 25,993,915	D152V	probably damaging	Het
Tmem200b	A	G	4: 131,922,537	D256G	probably damaging	Het
Tns1	A	T	1: 73,952,864	L885Q	probably damaging	Het
Umod	G	A	7: 119,472,421	Q366*	probably null	Het
Vsir	A	G	10: 60,364,263	I208V	probably damaging	Het
Zfp646	G	A	7: 127,880,499	R616H	probably damaging	Het

Other mutations in Ncoa1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00598:Ncoa1	APN	12	4278218	missense	probably benign
IGL01335:Ncoa1	APN	12	4297520	missense	probably benign	0.31
IGL02111:Ncoa1	APN	12	4274944	start codon destroyed	probably null
IGL02863:Ncoa1	APN	12	4297513	missense	probably benign	0.00
IGL02967:Ncoa1	APN	12	4295294	missense	probably damaging	1.00
IGL03007:Ncoa1	APN	12	4339114	missense	possibly damaging	0.92
IGL03031:Ncoa1	APN	12	4274818	missense	possibly damaging	0.76
IGL03048:Ncoa1	UTSW	12	4267922	missense	probably damaging	0.96
IGL03147:Ncoa1	UTSW	12	4259342	missense	probably damaging	1.00
PIT1430001:Ncoa1	UTSW	12	4323005	missense	probably benign	0.19
PIT4402001:Ncoa1	UTSW	12	4294987	missense	probably benign	0.00
R0002:Ncoa1	UTSW	12	4290885	missense	probably benign	0.00
R0011:Ncoa1	UTSW	12	4322896	missense	possibly damaging	0.94
R0389:Ncoa1	UTSW	12	4295976	missense	probably benign	0.05
R0467:Ncoa1	UTSW	12	4267687	missense	possibly damaging	0.49
R0480:Ncoa1	UTSW	12	4339105	missense	probably damaging	1.00
R0541:Ncoa1	UTSW	12	4323033	missense	probably damaging	1.00
R0671:Ncoa1	UTSW	12	4249758	splice site	probably null
R1387:Ncoa1	UTSW	12	4274790	missense	probably benign	0.01
R1426:Ncoa1	UTSW	12	4270737	splice site	probably benign
R1538:Ncoa1	UTSW	12	4270748	missense	possibly damaging	0.94
R1577:Ncoa1	UTSW	12	4295196	missense	probably damaging	0.99
R1902:Ncoa1	UTSW	12	4339049	missense	possibly damaging	0.78
R1905:Ncoa1	UTSW	12	4295433	missense	probably damaging	1.00
R2026:Ncoa1	UTSW	12	4267647	missense	probably benign	0.19
R2259:Ncoa1	UTSW	12	4315819	missense	probably damaging	1.00
R2317:Ncoa1	UTSW	12	4275189	missense	probably damaging	0.99
R3608:Ncoa1	UTSW	12	4278186	missense	probably benign	0.00
R4042:Ncoa1	UTSW	12	4267871	missense	probably damaging	0.99
R4688:Ncoa1	UTSW	12	4315781	missense	probably benign	0.26
R4763:Ncoa1	UTSW	12	4275297	missense	probably damaging	1.00
R4878:Ncoa1	UTSW	12	4275004	missense	probably damaging	1.00
R5531:Ncoa1	UTSW	12	4253746	missense	probably benign
R6393:Ncoa1	UTSW	12	4278181	missense	probably benign	0.00
R6711:Ncoa1	UTSW	12	4322904	missense	probably benign	0.26
R7066:Ncoa1	UTSW	12	4322934	missense	possibly damaging	0.90
R7109:Ncoa1	UTSW	12	4322978	missense	possibly damaging	0.63
R7170:Ncoa1	UTSW	12	4249722	missense	probably benign	0.32
R7395:Ncoa1	UTSW	12	4295188	missense	not run
R7453:Ncoa1	UTSW	12	4259307	missense	probably damaging	1.00
R7556:Ncoa1	UTSW	12	4270794	missense	probably damaging	0.98
R7821:Ncoa1	UTSW	12	4296221	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- ACATACCTGGTTTTCCTTGGTAG -3'
(R):5'- TTCACCACTGAGGAGGGAAC -3'

Sequencing Primer
(F):5'- ATACCTGGTTTTCCTTGGTAGTTGAC -3'
(R):5'- CCCATTAGGCAGAATTCAGAATG -3'

Posted On

2016-06-06