Mutagenetix > Incidental Mutations

Incidental Mutation 'R5062:Hectd1'

386705

Institutional Source

Beutler Lab

Gene Symbol

Hectd1

Ensembl Gene

ENSMUSG00000035247

Gene Name

HECT domain E3 ubiquitin protein ligase 1

Synonyms

b2b327Clo, opm, A630086P08Rik

MMRRC Submission

042652-MU

Accession Numbers

Genbank: NM_144788; MGI: 2384768

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R5062 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

51743722-51829536 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 51744879 bp

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Serine at position 2536 (C2536S)

Ref Sequence

ENSEMBL: ENSMUSP00000136449 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000042052] [ENSMUST00000179265] [ENSMUST00000218820]

Predicted Effect

probably benign
Transcript: ENSMUST00000042052
AA Change: C2528S

PolyPhen 2 Score 0.184 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000046766
Gene: ENSMUSG00000035247
AA Change: C2528S

Domain	Start	End	E-Value	Type
low complexity region	317	331	N/A	INTRINSIC
ANK	395	424	1.44e-1	SMART
ANK	426	455	2.81e-4	SMART
ANK	459	488	1.55e2	SMART
low complexity region	490	509	N/A	INTRINSIC
low complexity region	630	654	N/A	INTRINSIC
low complexity region	707	723	N/A	INTRINSIC
low complexity region	821	832	N/A	INTRINSIC
Pfam:Sad1_UNC	1107	1240	9.2e-27	PFAM
low complexity region	1259	1271	N/A	INTRINSIC
Pfam:MIB_HERC2	1277	1338	7.6e-27	PFAM
low complexity region	1373	1401	N/A	INTRINSIC
low complexity region	1441	1458	N/A	INTRINSIC
low complexity region	1484	1495	N/A	INTRINSIC
low complexity region	1508	1524	N/A	INTRINSIC
low complexity region	1600	1630	N/A	INTRINSIC
low complexity region	1633	1651	N/A	INTRINSIC
low complexity region	1674	1703	N/A	INTRINSIC
low complexity region	1745	1752	N/A	INTRINSIC
PDB:2LC3\|A	1879	1966	4e-57	PDB
low complexity region	2101	2117	N/A	INTRINSIC
HECTc	2143	2610	8.32e-76	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000158721

Predicted Effect

probably damaging
Transcript: ENSMUST00000179265
AA Change: C2536S

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000136449
Gene: ENSMUSG00000035247
AA Change: C2536S

Domain	Start	End	E-Value	Type
low complexity region	317	331	N/A	INTRINSIC
ANK	396	425	1.44e-1	SMART
ANK	427	456	2.81e-4	SMART
ANK	460	489	1.55e2	SMART
low complexity region	491	510	N/A	INTRINSIC
low complexity region	631	655	N/A	INTRINSIC
low complexity region	708	724	N/A	INTRINSIC
low complexity region	822	833	N/A	INTRINSIC
Pfam:Sad1_UNC	1112	1245	1.3e-26	PFAM
low complexity region	1264	1276	N/A	INTRINSIC
Pfam:MIB_HERC2	1282	1341	5.3e-26	PFAM
low complexity region	1378	1406	N/A	INTRINSIC
low complexity region	1446	1463	N/A	INTRINSIC
low complexity region	1489	1500	N/A	INTRINSIC
low complexity region	1513	1529	N/A	INTRINSIC
low complexity region	1605	1635	N/A	INTRINSIC
low complexity region	1638	1656	N/A	INTRINSIC
low complexity region	1679	1708	N/A	INTRINSIC
low complexity region	1750	1757	N/A	INTRINSIC
PDB:2LC3\|A	1884	1971	3e-57	PDB
low complexity region	2106	2122	N/A	INTRINSIC
HECTc	2148	2618	4.5e-72	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000218820

Meta Mutation Damage Score

0.1579

Coding Region Coverage

1x: 99.0%
3x: 98.2%
10x: 95.7%
20x: 90.1%

Validation Efficiency

100% (79/79)

MGI Phenotype

PHENOTYPE: Mice that are homozygous for either a gene trapped or an ENU-induced allele exhibit exencephaly associated with impaired head mesenchyme development and neural tube closure, and show eye and cranial vault dysplasia. Homozygotes for another ENU-induced allele show congenital cardiovascular defects. [provided by MGI curators]

Allele List at MGI

All alleles(30) : Gene trapped(29) Chemically induced(1)

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca6	A	T	11: 110,177,066	I1593N	probably benign	Het
Akr1b10	G	T	6: 34,392,106	K173N	probably damaging	Het
Artn	A	T	4: 117,927,676	L3Q	probably damaging	Het
Asxl3	T	A	18: 22,522,718	S1262T	possibly damaging	Het
Atp6v0a4	A	T	6: 38,074,183	M420K	probably benign	Het
Bcam	T	A	7: 19,760,101	T422S	possibly damaging	Het
Casp2	C	T	6: 42,269,272		probably benign	Het
Ccdc137	A	G	11: 120,462,515		probably benign	Het
Cd177	C	A	7: 24,744,316	A786S	probably benign	Het
Cdca4	T	C	12: 112,821,863	N82D	probably benign	Het
Clu	A	C	14: 65,979,728	T337P	probably damaging	Het
Col6a3	A	C	1: 90,779,352	I2013S	unknown	Het
Cpne9	T	A	6: 113,304,488	M510K	probably damaging	Het
Cyp3a13	A	C	5: 137,898,899	N384K	possibly damaging	Het
Fam186a	A	C	15: 99,944,646	I1239S	possibly damaging	Het
Fryl	T	C	5: 73,075,893	E413G	possibly damaging	Het
Fscn2	A	C	11: 120,366,749	Y312S	probably damaging	Het
Fshr	A	T	17: 88,986,046	C401*	probably null	Het
Glyat	A	C	19: 12,650,263	Q74P	probably damaging	Het
Gm5724	A	C	6: 141,767,454	M67R	possibly damaging	Het
Gm6158	A	T	14: 24,070,090		noncoding transcript	Het
Grm7	A	G	6: 110,646,136	N90S	probably damaging	Het
Herc3	C	T	6: 58,855,760	Q137*	probably null	Het
Kctd3	A	C	1: 188,995,693		probably benign	Het
Klhl30	A	G	1: 91,355,578	T301A	probably benign	Het
Klra9	T	C	6: 130,179,109	K228E	possibly damaging	Het
Lamc3	A	T	2: 31,905,667	T355S	possibly damaging	Het
Lcmt1	A	C	7: 123,410,830		probably null	Het
Limch1	C	T	5: 66,969,235	P60S	probably damaging	Het
Lrfn2	A	G	17: 49,070,500	D203G	probably damaging	Het
Mc5r	T	C	18: 68,339,281	L237P	probably damaging	Het
Mknk2	G	A	10: 80,671,769	R58W	probably damaging	Het
Mrgpra2b	T	C	7: 47,502,928		probably benign	Het
Mroh2a	GCCC	GC	1: 88,232,257		probably null	Het
Nae1	A	T	8: 104,516,702	C395S	possibly damaging	Het
Ncoa1	A	G	12: 4,259,333	M1321T	probably damaging	Het
Neb	A	C	2: 52,280,501	F1720V	possibly damaging	Het
Nectin2	C	T	7: 19,738,273	V64I	probably benign	Het
Nisch	T	A	14: 31,172,440	T1145S	probably damaging	Het
Nlrp5	A	T	7: 23,435,910	R1009*	probably null	Het
Olfr103	A	T	17: 37,336,931	H100Q	probably damaging	Het
Olfr727	T	A	14: 50,127,437	Y287N	probably damaging	Het
Otx1	C	A	11: 21,997,037	A91S	probably damaging	Het
Pak1ip1	A	G	13: 41,008,145		probably benign	Het
Pcm1	T	C	8: 41,259,260	V189A	probably damaging	Het
Peak1	G	T	9: 56,260,289	N118K	probably damaging	Het
Phgdh	T	A	3: 98,328,339	I121F	probably damaging	Het
Pi4ka	G	T	16: 17,309,397	A1064E	probably benign	Het
Pkhd1	A	C	1: 20,585,711	C199W	probably benign	Het
Plat	A	G	8: 22,772,311	D117G	probably benign	Het
Ppp2r2b	C	A	18: 42,688,461	V211L	possibly damaging	Het
Ptgs1	A	G	2: 36,237,282	D60G	probably damaging	Het
Ryr2	T	C	13: 11,700,354	E2776G	probably damaging	Het
Sema4c	C	T	1: 36,552,978		probably null	Het
Sharpin	T	C	15: 76,347,611		probably benign	Het
Slamf6	A	G	1: 171,936,533	I164M	possibly damaging	Het
Spef1	A	G	2: 131,173,281	Y46H	probably damaging	Het
Spns1	G	A	7: 126,374,329		probably benign	Het
Supt5	C	T	7: 28,329,015		probably null	Het
Tbx5	T	A	5: 119,836,922	D3E	probably damaging	Het
Thbs1	T	C	2: 118,121,237		probably null	Het
Tmem140	G	A	6: 34,872,962	V138M	probably damaging	Het
Tmem200a	T	A	10: 25,993,915	D152V	probably damaging	Het
Tmem200b	A	G	4: 131,922,537	D256G	probably damaging	Het
Tns1	A	T	1: 73,952,864	L885Q	probably damaging	Het
Umod	G	A	7: 119,472,421	Q366*	probably null	Het
Vsir	A	G	10: 60,364,263	I208V	probably damaging	Het
Zfp646	G	A	7: 127,880,499	R616H	probably damaging	Het

Other mutations in Hectd1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00402:Hectd1	APN	12	51769108	missense	possibly damaging	0.94
IGL00402:Hectd1	APN	12	51759432	missense	probably benign
IGL00419:Hectd1	APN	12	51764035	missense	probably damaging	0.99
IGL00518:Hectd1	APN	12	51776489	splice site	probably benign
IGL00565:Hectd1	APN	12	51790398	missense	probably damaging	0.97
IGL00574:Hectd1	APN	12	51774004	missense	probably benign	0.17
IGL00576:Hectd1	APN	12	51759309	missense	probably damaging	0.99
IGL00788:Hectd1	APN	12	51748788	missense	probably damaging	0.99
IGL00978:Hectd1	APN	12	51791390	missense	possibly damaging	0.95
IGL01328:Hectd1	APN	12	51761121	missense	probably damaging	1.00
IGL01337:Hectd1	APN	12	51802274	missense	possibly damaging	0.95
IGL01634:Hectd1	APN	12	51803779	missense	probably damaging	0.98
IGL01731:Hectd1	APN	12	51802810	missense	possibly damaging	0.59
IGL01920:Hectd1	APN	12	51782554	missense	probably damaging	0.99
IGL01951:Hectd1	APN	12	51794497	nonsense	probably null
IGL01994:Hectd1	APN	12	51797942	missense	probably damaging	0.99
IGL02140:Hectd1	APN	12	51774137	missense	probably damaging	0.99
IGL02150:Hectd1	APN	12	51769191	missense	probably damaging	0.97
IGL02156:Hectd1	APN	12	51754133	splice site	probably benign
IGL02177:Hectd1	APN	12	51772320	missense	probably damaging	0.99
IGL02502:Hectd1	APN	12	51797852	missense	possibly damaging	0.77
IGL02505:Hectd1	APN	12	51800713	critical splice donor site	probably null
IGL02519:Hectd1	APN	12	51769111	missense	probably damaging	0.99
IGL02624:Hectd1	APN	12	51762450	missense	possibly damaging	0.61
IGL02833:Hectd1	APN	12	51764081	missense	probably damaging	0.96
IGL02851:Hectd1	APN	12	51767640	missense	possibly damaging	0.94
IGL02866:Hectd1	APN	12	51790613	missense	probably damaging	1.00
IGL02981:Hectd1	APN	12	51768887	missense	possibly damaging	0.70
IGL02987:Hectd1	APN	12	51744767	missense	probably damaging	1.00
IGL02999:Hectd1	APN	12	51827422	missense	possibly damaging	0.77
IGL03071:Hectd1	APN	12	51769174	missense	probably benign	0.00
IGL03078:Hectd1	APN	12	51802236	missense	probably damaging	0.98
IGL03299:Hectd1	APN	12	51800888	splice site	probably benign
3-1:Hectd1	UTSW	12	51753807	missense	probably damaging	0.99
R0039:Hectd1	UTSW	12	51753825	missense	possibly damaging	0.83
R0238:Hectd1	UTSW	12	51769318	missense	possibly damaging	0.72
R0238:Hectd1	UTSW	12	51769318	missense	possibly damaging	0.72
R0239:Hectd1	UTSW	12	51769318	missense	possibly damaging	0.72
R0239:Hectd1	UTSW	12	51769318	missense	possibly damaging	0.72
R0268:Hectd1	UTSW	12	51769107	missense	probably damaging	0.99
R0268:Hectd1	UTSW	12	51769108	missense	possibly damaging	0.94
R0409:Hectd1	UTSW	12	51782556	missense	possibly damaging	0.59
R1019:Hectd1	UTSW	12	51748657	missense	probably damaging	0.99
R1072:Hectd1	UTSW	12	51761072	missense	probably benign	0.11
R1087:Hectd1	UTSW	12	51776572	missense	probably damaging	0.99
R1165:Hectd1	UTSW	12	51764164	splice site	probably benign
R1350:Hectd1	UTSW	12	51762434	missense	probably benign
R1553:Hectd1	UTSW	12	51773878	missense	probably damaging	0.98
R1666:Hectd1	UTSW	12	51753824	missense	possibly damaging	0.91
R1676:Hectd1	UTSW	12	51744788	missense	probably damaging	1.00
R1694:Hectd1	UTSW	12	51744592	missense	probably damaging	1.00
R1778:Hectd1	UTSW	12	51753807	missense	probably damaging	0.99
R1856:Hectd1	UTSW	12	51744794	missense	probably damaging	1.00
R1859:Hectd1	UTSW	12	51806567	missense	probably damaging	1.00
R1884:Hectd1	UTSW	12	51800955	missense	probably benign	0.00
R1982:Hectd1	UTSW	12	51785841	missense	probably damaging	0.97
R2034:Hectd1	UTSW	12	51757116	splice site	probably null
R2061:Hectd1	UTSW	12	51794444	missense	probably damaging	0.99
R2078:Hectd1	UTSW	12	51748542	missense	probably damaging	0.99
R2176:Hectd1	UTSW	12	51745494	missense	probably damaging	1.00
R2210:Hectd1	UTSW	12	51806462	missense	probably damaging	0.99
R2248:Hectd1	UTSW	12	51806471	missense	probably damaging	0.99
R2282:Hectd1	UTSW	12	51769008	missense	possibly damaging	0.95
R2402:Hectd1	UTSW	12	51745534	missense	probably benign	0.01
R3876:Hectd1	UTSW	12	51768730	missense	probably damaging	0.98
R4027:Hectd1	UTSW	12	51802436	critical splice acceptor site	probably null
R4085:Hectd1	UTSW	12	51774750	missense	possibly damaging	0.93
R4115:Hectd1	UTSW	12	51768723	nonsense	probably null
R4116:Hectd1	UTSW	12	51768723	nonsense	probably null
R4169:Hectd1	UTSW	12	51790225	missense	probably damaging	0.97
R4434:Hectd1	UTSW	12	51752052	missense	probably damaging	1.00
R4507:Hectd1	UTSW	12	51790493	missense	probably damaging	0.97
R4578:Hectd1	UTSW	12	51751932	missense	probably damaging	1.00
R4579:Hectd1	UTSW	12	51744573	missense	probably damaging	0.97
R4709:Hectd1	UTSW	12	51787912	missense	possibly damaging	0.94
R4812:Hectd1	UTSW	12	51827351	critical splice donor site	probably null
R4883:Hectd1	UTSW	12	51784247	nonsense	probably null
R4885:Hectd1	UTSW	12	51800722	missense	probably damaging	0.97
R4975:Hectd1	UTSW	12	51762497	missense	probably benign	0.02
R4983:Hectd1	UTSW	12	51784262	missense	probably benign	0.01
R5007:Hectd1	UTSW	12	51802660	missense	possibly damaging	0.95
R5046:Hectd1	UTSW	12	51750388	missense	probably damaging	1.00
R5164:Hectd1	UTSW	12	51827489	start codon destroyed	probably null	0.60
R5213:Hectd1	UTSW	12	51802533	critical splice donor site	probably null
R5535:Hectd1	UTSW	12	51802326	missense	probably damaging	0.98
R5776:Hectd1	UTSW	12	51764114	missense	possibly damaging	0.91
R5846:Hectd1	UTSW	12	51773835	missense	probably damaging	0.99
R5907:Hectd1	UTSW	12	51798754	missense	probably damaging	0.98
R5911:Hectd1	UTSW	12	51802252	missense	probably damaging	0.99
R5919:Hectd1	UTSW	12	51769072	missense	probably damaging	0.98
R6051:Hectd1	UTSW	12	51754104	missense	probably benign
R6141:Hectd1	UTSW	12	51746092	critical splice donor site	probably null
R6172:Hectd1	UTSW	12	51769282	missense	probably damaging	1.00
R6194:Hectd1	UTSW	12	51748445	missense	probably damaging	0.99
R6356:Hectd1	UTSW	12	51744619	missense	probably damaging	1.00
R6795:Hectd1	UTSW	12	51794487	missense	possibly damaging	0.94
R6909:Hectd1	UTSW	12	51764162	splice site	probably null
R6971:Hectd1	UTSW	12	51748743	nonsense	probably null
R7079:Hectd1	UTSW	12	51787855	missense	possibly damaging	0.96
R7104:Hectd1	UTSW	12	51827351	critical splice donor site	probably null
R7171:Hectd1	UTSW	12	51759297	missense	probably damaging	0.99
R7296:Hectd1	UTSW	12	51785852	missense	possibly damaging	0.73
R7346:Hectd1	UTSW	12	51750321	missense	probably benign
R7355:Hectd1	UTSW	12	51791298	missense	possibly damaging	0.72
R7468:Hectd1	UTSW	12	51744805	synonymous	probably null
R7531:Hectd1	UTSW	12	51806367	missense	probably benign	0.33
R7532:Hectd1	UTSW	12	51790450	missense	probably damaging	0.98
R7755:Hectd1	UTSW	12	51802220	missense	possibly damaging	0.86
R7807:Hectd1	UTSW	12	51745388	missense	probably damaging	1.00
R7842:Hectd1	UTSW	12	51772560	missense	probably damaging	0.99
R7925:Hectd1	UTSW	12	51772560	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- ATGGATAGCTCGCATCAGTAGC -3'
(R):5'- AAGTAGTCACCCTGGGCAAC -3'

Sequencing Primer
(F):5'- GATAGCTCGCATCAGTAGCATCAAC -3'
(R):5'- CAGAAGCAGTCGGGTTTT -3'

Posted On

2016-06-06