Incidental Mutation 'R5062:Cdca4'
ID386706
Institutional Source Beutler Lab
Gene Symbol Cdca4
Ensembl Gene ENSMUSG00000047832
Gene Namecell division cycle associated 4
Synonyms2410018C03Rik, SEI-3, Hepp
MMRRC Submission 042652-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.508) question?
Stock #R5062 (G1)
Quality Score201
Status Validated
Chromosome12
Chromosomal Location112820229-112829423 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 112821863 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 82 (N82D)
Ref Sequence ENSEMBL: ENSMUSP00000152315 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062092] [ENSMUST00000220899]
Predicted Effect probably benign
Transcript: ENSMUST00000062092
AA Change: N82D

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000058901
Gene: ENSMUSG00000047832
AA Change: N82D

DomainStartEndE-ValueType
Pfam:SERTA 33 70 9.1e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000220899
AA Change: N82D

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.7%
  • 20x: 90.1%
Validation Efficiency 100% (79/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the E2F family of transcription factors. This protein regulates E2F-dependent transcriptional activation and cell proliferation, mainly through the E2F/retinoblastoma protein pathway. It also functions in the regulation of JUN oncogene expression. This protein shows distinctive nuclear-mitotic apparatus distribution, it is involved in spindle organization from prometaphase, and may also play a role as a midzone factor involved in chromosome segregation or cytokinesis. Two alternatively spliced transcript variants encoding the same protein have been noted for this gene. Two pseudogenes have also been identified on chromosome 1. [provided by RefSeq, May 2014]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 A T 11: 110,177,066 I1593N probably benign Het
Akr1b10 G T 6: 34,392,106 K173N probably damaging Het
Artn A T 4: 117,927,676 L3Q probably damaging Het
Asxl3 T A 18: 22,522,718 S1262T possibly damaging Het
Atp6v0a4 A T 6: 38,074,183 M420K probably benign Het
Bcam T A 7: 19,760,101 T422S possibly damaging Het
Casp2 C T 6: 42,269,272 probably benign Het
Ccdc137 A G 11: 120,462,515 probably benign Het
Cd177 C A 7: 24,744,316 A786S probably benign Het
Clu A C 14: 65,979,728 T337P probably damaging Het
Col6a3 A C 1: 90,779,352 I2013S unknown Het
Cpne9 T A 6: 113,304,488 M510K probably damaging Het
Cyp3a13 A C 5: 137,898,899 N384K possibly damaging Het
Fam186a A C 15: 99,944,646 I1239S possibly damaging Het
Fryl T C 5: 73,075,893 E413G possibly damaging Het
Fscn2 A C 11: 120,366,749 Y312S probably damaging Het
Fshr A T 17: 88,986,046 C401* probably null Het
Glyat A C 19: 12,650,263 Q74P probably damaging Het
Gm5724 A C 6: 141,767,454 M67R possibly damaging Het
Gm6158 A T 14: 24,070,090 noncoding transcript Het
Grm7 A G 6: 110,646,136 N90S probably damaging Het
Hectd1 A T 12: 51,744,879 C2536S probably damaging Het
Herc3 C T 6: 58,855,760 Q137* probably null Het
Kctd3 A C 1: 188,995,693 probably benign Het
Klhl30 A G 1: 91,355,578 T301A probably benign Het
Klra9 T C 6: 130,179,109 K228E possibly damaging Het
Lamc3 A T 2: 31,905,667 T355S possibly damaging Het
Lcmt1 A C 7: 123,410,830 probably null Het
Limch1 C T 5: 66,969,235 P60S probably damaging Het
Lrfn2 A G 17: 49,070,500 D203G probably damaging Het
Mc5r T C 18: 68,339,281 L237P probably damaging Het
Mknk2 G A 10: 80,671,769 R58W probably damaging Het
Mrgpra2b T C 7: 47,502,928 probably benign Het
Mroh2a GCCC GC 1: 88,232,257 probably null Het
Nae1 A T 8: 104,516,702 C395S possibly damaging Het
Ncoa1 A G 12: 4,259,333 M1321T probably damaging Het
Neb A C 2: 52,280,501 F1720V possibly damaging Het
Nectin2 C T 7: 19,738,273 V64I probably benign Het
Nisch T A 14: 31,172,440 T1145S probably damaging Het
Nlrp5 A T 7: 23,435,910 R1009* probably null Het
Olfr103 A T 17: 37,336,931 H100Q probably damaging Het
Olfr727 T A 14: 50,127,437 Y287N probably damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pak1ip1 A G 13: 41,008,145 probably benign Het
Pcm1 T C 8: 41,259,260 V189A probably damaging Het
Peak1 G T 9: 56,260,289 N118K probably damaging Het
Phgdh T A 3: 98,328,339 I121F probably damaging Het
Pi4ka G T 16: 17,309,397 A1064E probably benign Het
Pkhd1 A C 1: 20,585,711 C199W probably benign Het
Plat A G 8: 22,772,311 D117G probably benign Het
Ppp2r2b C A 18: 42,688,461 V211L possibly damaging Het
Ptgs1 A G 2: 36,237,282 D60G probably damaging Het
Ryr2 T C 13: 11,700,354 E2776G probably damaging Het
Sema4c C T 1: 36,552,978 probably null Het
Sharpin T C 15: 76,347,611 probably benign Het
Slamf6 A G 1: 171,936,533 I164M possibly damaging Het
Spef1 A G 2: 131,173,281 Y46H probably damaging Het
Spns1 G A 7: 126,374,329 probably benign Het
Supt5 C T 7: 28,329,015 probably null Het
Tbx5 T A 5: 119,836,922 D3E probably damaging Het
Thbs1 T C 2: 118,121,237 probably null Het
Tmem140 G A 6: 34,872,962 V138M probably damaging Het
Tmem200a T A 10: 25,993,915 D152V probably damaging Het
Tmem200b A G 4: 131,922,537 D256G probably damaging Het
Tns1 A T 1: 73,952,864 L885Q probably damaging Het
Umod G A 7: 119,472,421 Q366* probably null Het
Vsir A G 10: 60,364,263 I208V probably damaging Het
Zfp646 G A 7: 127,880,499 R616H probably damaging Het
Other mutations in Cdca4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02839:Cdca4 APN 12 112821891 missense probably damaging 1.00
R1372:Cdca4 UTSW 12 112821917 nonsense probably null
R4410:Cdca4 UTSW 12 112821879 missense probably benign 0.00
R4450:Cdca4 UTSW 12 112821658 missense probably benign 0.02
R4835:Cdca4 UTSW 12 112821547 missense probably damaging 1.00
R5907:Cdca4 UTSW 12 112821719 missense probably benign 0.00
R7097:Cdca4 UTSW 12 112821569 missense probably benign 0.31
Predicted Primers PCR Primer
(F):5'- TGACTTCTGAAAGCTTCCCCTG -3'
(R):5'- AGAGGGTTTTGGCACTGTCC -3'

Sequencing Primer
(F):5'- TGTCCATCTCCCAGAGGCTG -3'
(R):5'- GGCACTGTCCCTTCCTATAGC -3'
Posted On2016-06-06