Incidental Mutation 'R5062:Clu'
ID386712
Institutional Source Beutler Lab
Gene Symbol Clu
Ensembl Gene ENSMUSG00000022037
Gene Nameclusterin
SynonymsD14Ucla3, Sgp-2, Sgp2, ApoJ, Cli, SP-40, Sugp-2, complement lysis inhibitor, Apolipoprotein J, testosterone repressed prostate message-2
MMRRC Submission 042652-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.291) question?
Stock #R5062 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location65968483-65981547 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 65979728 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Proline at position 337 (T337P)
Ref Sequence ENSEMBL: ENSMUSP00000022616 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022616] [ENSMUST00000127387] [ENSMUST00000128539] [ENSMUST00000138191] [ENSMUST00000138665] [ENSMUST00000144619] [ENSMUST00000153460]
Predicted Effect probably damaging
Transcript: ENSMUST00000022616
AA Change: T337P

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000022616
Gene: ENSMUSG00000022037
AA Change: T337P

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
CLb 22 226 9.93e-152 SMART
CLa 227 442 2.3e-156 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000127387
SMART Domains Protein: ENSMUSP00000114720
Gene: ENSMUSG00000022037

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
CLb 22 226 9.93e-152 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000128539
SMART Domains Protein: ENSMUSP00000121485
Gene: ENSMUSG00000022037

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
CLb 22 203 3.48e-124 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000138191
SMART Domains Protein: ENSMUSP00000117555
Gene: ENSMUSG00000022037

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
CLb 22 225 2.18e-148 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000138665
Predicted Effect probably benign
Transcript: ENSMUST00000144619
SMART Domains Protein: ENSMUSP00000117953
Gene: ENSMUSG00000022037

DomainStartEndE-ValueType
low complexity region 92 100 N/A INTRINSIC
CLb 110 209 1.16e-20 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152903
Predicted Effect probably benign
Transcript: ENSMUST00000153460
SMART Domains Protein: ENSMUSP00000121633
Gene: ENSMUSG00000022037

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
CLb 22 226 9.93e-152 SMART
Blast:CLa 227 265 2e-19 BLAST
Meta Mutation Damage Score 0.2296 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.7%
  • 20x: 90.1%
Validation Efficiency 100% (79/79)
MGI Phenotype FUNCTION: The protein encoded by this gene is a secreted chaperone that can, under some stress conditions, also be found in the cell cytosol. It has been suggested to be involved in several basic biological events such as cell death, tumor progression, and neurodegenerative disorders. The encoded preproprotein undergoes proteolytic processing to generate a disulfide-linked heterodimeric mature protein comprised of alpha and beta subunits. Mice lacking the encoded protein exhibit increased severity of autoimmune myocarditis, faster progression of the acute inflammation to myocardial scarring and decreased brain injury following neonatal hypoxic-ischemic injury. [provided by RefSeq, Nov 2015]
PHENOTYPE: Homozygous inactivation of this gene leads to progressive renal glomerulopathy and increased severity of myosin-induced autoimmune myocarditis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 A T 11: 110,177,066 I1593N probably benign Het
Akr1b10 G T 6: 34,392,106 K173N probably damaging Het
Artn A T 4: 117,927,676 L3Q probably damaging Het
Asxl3 T A 18: 22,522,718 S1262T possibly damaging Het
Atp6v0a4 A T 6: 38,074,183 M420K probably benign Het
Bcam T A 7: 19,760,101 T422S possibly damaging Het
Casp2 C T 6: 42,269,272 probably benign Het
Ccdc137 A G 11: 120,462,515 probably benign Het
Cd177 C A 7: 24,744,316 A786S probably benign Het
Cdca4 T C 12: 112,821,863 N82D probably benign Het
Col6a3 A C 1: 90,779,352 I2013S unknown Het
Cpne9 T A 6: 113,304,488 M510K probably damaging Het
Cyp3a13 A C 5: 137,898,899 N384K possibly damaging Het
Fam186a A C 15: 99,944,646 I1239S possibly damaging Het
Fryl T C 5: 73,075,893 E413G possibly damaging Het
Fscn2 A C 11: 120,366,749 Y312S probably damaging Het
Fshr A T 17: 88,986,046 C401* probably null Het
Glyat A C 19: 12,650,263 Q74P probably damaging Het
Gm5724 A C 6: 141,767,454 M67R possibly damaging Het
Gm6158 A T 14: 24,070,090 noncoding transcript Het
Grm7 A G 6: 110,646,136 N90S probably damaging Het
Hectd1 A T 12: 51,744,879 C2536S probably damaging Het
Herc3 C T 6: 58,855,760 Q137* probably null Het
Kctd3 A C 1: 188,995,693 probably benign Het
Klhl30 A G 1: 91,355,578 T301A probably benign Het
Klra9 T C 6: 130,179,109 K228E possibly damaging Het
Lamc3 A T 2: 31,905,667 T355S possibly damaging Het
Lcmt1 A C 7: 123,410,830 probably null Het
Limch1 C T 5: 66,969,235 P60S probably damaging Het
Lrfn2 A G 17: 49,070,500 D203G probably damaging Het
Mc5r T C 18: 68,339,281 L237P probably damaging Het
Mknk2 G A 10: 80,671,769 R58W probably damaging Het
Mrgpra2b T C 7: 47,502,928 probably benign Het
Mroh2a GCCC GC 1: 88,232,257 probably null Het
Nae1 A T 8: 104,516,702 C395S possibly damaging Het
Ncoa1 A G 12: 4,259,333 M1321T probably damaging Het
Neb A C 2: 52,280,501 F1720V possibly damaging Het
Nectin2 C T 7: 19,738,273 V64I probably benign Het
Nisch T A 14: 31,172,440 T1145S probably damaging Het
Nlrp5 A T 7: 23,435,910 R1009* probably null Het
Olfr103 A T 17: 37,336,931 H100Q probably damaging Het
Olfr727 T A 14: 50,127,437 Y287N probably damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pak1ip1 A G 13: 41,008,145 probably benign Het
Pcm1 T C 8: 41,259,260 V189A probably damaging Het
Peak1 G T 9: 56,260,289 N118K probably damaging Het
Phgdh T A 3: 98,328,339 I121F probably damaging Het
Pi4ka G T 16: 17,309,397 A1064E probably benign Het
Pkhd1 A C 1: 20,585,711 C199W probably benign Het
Plat A G 8: 22,772,311 D117G probably benign Het
Ppp2r2b C A 18: 42,688,461 V211L possibly damaging Het
Ptgs1 A G 2: 36,237,282 D60G probably damaging Het
Ryr2 T C 13: 11,700,354 E2776G probably damaging Het
Sema4c C T 1: 36,552,978 probably null Het
Sharpin T C 15: 76,347,611 probably benign Het
Slamf6 A G 1: 171,936,533 I164M possibly damaging Het
Spef1 A G 2: 131,173,281 Y46H probably damaging Het
Spns1 G A 7: 126,374,329 probably benign Het
Supt5 C T 7: 28,329,015 probably null Het
Tbx5 T A 5: 119,836,922 D3E probably damaging Het
Thbs1 T C 2: 118,121,237 probably null Het
Tmem140 G A 6: 34,872,962 V138M probably damaging Het
Tmem200a T A 10: 25,993,915 D152V probably damaging Het
Tmem200b A G 4: 131,922,537 D256G probably damaging Het
Tns1 A T 1: 73,952,864 L885Q probably damaging Het
Umod G A 7: 119,472,421 Q366* probably null Het
Vsir A G 10: 60,364,263 I208V probably damaging Het
Zfp646 G A 7: 127,880,499 R616H probably damaging Het
Other mutations in Clu
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01339:Clu APN 14 65975588 missense probably damaging 0.98
IGL01657:Clu APN 14 65979672 missense possibly damaging 0.81
IGL02030:Clu APN 14 65975791 missense probably benign 0.08
IGL02891:Clu APN 14 65975984 missense probably damaging 0.96
IGL03163:Clu APN 14 65979786 missense probably benign 0.06
R1378:Clu UTSW 14 65974901 missense probably damaging 1.00
R1417:Clu UTSW 14 65974971 nonsense probably null
R1711:Clu UTSW 14 65980905 missense possibly damaging 0.63
R2134:Clu UTSW 14 65974841 critical splice acceptor site probably null
R2285:Clu UTSW 14 65980959 missense probably benign 0.03
R2340:Clu UTSW 14 65980909 missense probably damaging 0.99
R2508:Clu UTSW 14 65975003 missense probably damaging 1.00
R4700:Clu UTSW 14 65979864 missense probably benign 0.25
R4981:Clu UTSW 14 65973366 missense probably damaging 0.97
R5422:Clu UTSW 14 65975602 missense probably damaging 0.99
R6389:Clu UTSW 14 65971322 intron probably benign
R7009:Clu UTSW 14 65971832 missense probably damaging 1.00
X0025:Clu UTSW 14 65971814 missense probably damaging 1.00
Z1088:Clu UTSW 14 65976913 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AAGAGCTGATCTGTAGCCCTCC -3'
(R):5'- AGCCTCATCAAATGACTGGG -3'

Sequencing Primer
(F):5'- AAGAGTTCCTCTGCTTCAGATTG -3'
(R):5'- CTGGGATACAACTCACGGTG -3'
Posted On2016-06-06