Incidental Mutation 'R5062:Lrfn2'
ID386717
Institutional Source Beutler Lab
Gene Symbol Lrfn2
Ensembl Gene ENSMUSG00000040490
Gene Nameleucine rich repeat and fibronectin type III domain containing 2
Synonyms5730420O05Rik, SALM1
MMRRC Submission 042652-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5062 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location48932379-49097588 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 49070500 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 203 (D203G)
Ref Sequence ENSEMBL: ENSMUSP00000047573 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046254]
Predicted Effect probably damaging
Transcript: ENSMUST00000046254
AA Change: D203G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000047573
Gene: ENSMUSG00000040490
AA Change: D203G

DomainStartEndE-ValueType
low complexity region 4 16 N/A INTRINSIC
LRRNT 20 56 2.9e0 SMART
LRR 75 98 7.36e0 SMART
LRR_TYP 99 122 1.1e-2 SMART
LRR_TYP 123 146 2.2e-2 SMART
LRR 148 171 4.45e1 SMART
LRR_TYP 172 195 1.56e-2 SMART
LRR 196 220 1.06e1 SMART
LRRCT 242 287 5.53e-4 SMART
IGc2 301 366 8e-12 SMART
low complexity region 401 415 N/A INTRINSIC
FN3 420 500 1.52e-1 SMART
transmembrane domain 533 555 N/A INTRINSIC
low complexity region 613 654 N/A INTRINSIC
Meta Mutation Damage Score 0.8295 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.7%
  • 20x: 90.1%
Validation Efficiency 100% (79/79)
MGI Phenotype PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit small spleens, small or no thymi, impaired T cell development, and decreased T cell proliferation in response to mitogen. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 A T 11: 110,177,066 I1593N probably benign Het
Akr1b10 G T 6: 34,392,106 K173N probably damaging Het
Artn A T 4: 117,927,676 L3Q probably damaging Het
Asxl3 T A 18: 22,522,718 S1262T possibly damaging Het
Atp6v0a4 A T 6: 38,074,183 M420K probably benign Het
Bcam T A 7: 19,760,101 T422S possibly damaging Het
Casp2 C T 6: 42,269,272 probably benign Het
Ccdc137 A G 11: 120,462,515 probably benign Het
Cd177 C A 7: 24,744,316 A786S probably benign Het
Cdca4 T C 12: 112,821,863 N82D probably benign Het
Clu A C 14: 65,979,728 T337P probably damaging Het
Col6a3 A C 1: 90,779,352 I2013S unknown Het
Cpne9 T A 6: 113,304,488 M510K probably damaging Het
Cyp3a13 A C 5: 137,898,899 N384K possibly damaging Het
Fam186a A C 15: 99,944,646 I1239S possibly damaging Het
Fryl T C 5: 73,075,893 E413G possibly damaging Het
Fscn2 A C 11: 120,366,749 Y312S probably damaging Het
Fshr A T 17: 88,986,046 C401* probably null Het
Glyat A C 19: 12,650,263 Q74P probably damaging Het
Gm5724 A C 6: 141,767,454 M67R possibly damaging Het
Gm6158 A T 14: 24,070,090 noncoding transcript Het
Grm7 A G 6: 110,646,136 N90S probably damaging Het
Hectd1 A T 12: 51,744,879 C2536S probably damaging Het
Herc3 C T 6: 58,855,760 Q137* probably null Het
Kctd3 A C 1: 188,995,693 probably benign Het
Klhl30 A G 1: 91,355,578 T301A probably benign Het
Klra9 T C 6: 130,179,109 K228E possibly damaging Het
Lamc3 A T 2: 31,905,667 T355S possibly damaging Het
Lcmt1 A C 7: 123,410,830 probably null Het
Limch1 C T 5: 66,969,235 P60S probably damaging Het
Mc5r T C 18: 68,339,281 L237P probably damaging Het
Mknk2 G A 10: 80,671,769 R58W probably damaging Het
Mrgpra2b T C 7: 47,502,928 probably benign Het
Mroh2a GCCC GC 1: 88,232,257 probably null Het
Nae1 A T 8: 104,516,702 C395S possibly damaging Het
Ncoa1 A G 12: 4,259,333 M1321T probably damaging Het
Neb A C 2: 52,280,501 F1720V possibly damaging Het
Nectin2 C T 7: 19,738,273 V64I probably benign Het
Nisch T A 14: 31,172,440 T1145S probably damaging Het
Nlrp5 A T 7: 23,435,910 R1009* probably null Het
Olfr103 A T 17: 37,336,931 H100Q probably damaging Het
Olfr727 T A 14: 50,127,437 Y287N probably damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pak1ip1 A G 13: 41,008,145 probably benign Het
Pcm1 T C 8: 41,259,260 V189A probably damaging Het
Peak1 G T 9: 56,260,289 N118K probably damaging Het
Phgdh T A 3: 98,328,339 I121F probably damaging Het
Pi4ka G T 16: 17,309,397 A1064E probably benign Het
Pkhd1 A C 1: 20,585,711 C199W probably benign Het
Plat A G 8: 22,772,311 D117G probably benign Het
Ppp2r2b C A 18: 42,688,461 V211L possibly damaging Het
Ptgs1 A G 2: 36,237,282 D60G probably damaging Het
Ryr2 T C 13: 11,700,354 E2776G probably damaging Het
Sema4c C T 1: 36,552,978 probably null Het
Sharpin T C 15: 76,347,611 probably benign Het
Slamf6 A G 1: 171,936,533 I164M possibly damaging Het
Spef1 A G 2: 131,173,281 Y46H probably damaging Het
Spns1 G A 7: 126,374,329 probably benign Het
Supt5 C T 7: 28,329,015 probably null Het
Tbx5 T A 5: 119,836,922 D3E probably damaging Het
Thbs1 T C 2: 118,121,237 probably null Het
Tmem140 G A 6: 34,872,962 V138M probably damaging Het
Tmem200a T A 10: 25,993,915 D152V probably damaging Het
Tmem200b A G 4: 131,922,537 D256G probably damaging Het
Tns1 A T 1: 73,952,864 L885Q probably damaging Het
Umod G A 7: 119,472,421 Q366* probably null Het
Vsir A G 10: 60,364,263 I208V probably damaging Het
Zfp646 G A 7: 127,880,499 R616H probably damaging Het
Other mutations in Lrfn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01612:Lrfn2 APN 17 49070397 missense possibly damaging 0.81
IGL01989:Lrfn2 APN 17 49071085 missense probably damaging 1.00
IGL03324:Lrfn2 APN 17 49070887 missense probably damaging 1.00
IGL02991:Lrfn2 UTSW 17 49070704 missense probably damaging 1.00
R0306:Lrfn2 UTSW 17 49096255 missense probably damaging 0.99
R0539:Lrfn2 UTSW 17 49071044 missense probably damaging 1.00
R1245:Lrfn2 UTSW 17 49096249 critical splice acceptor site probably null
R1414:Lrfn2 UTSW 17 49070829 missense probably benign 0.01
R1437:Lrfn2 UTSW 17 49071225 missense probably damaging 0.97
R1670:Lrfn2 UTSW 17 49096577 missense probably benign 0.01
R2358:Lrfn2 UTSW 17 49071160 missense possibly damaging 0.92
R3711:Lrfn2 UTSW 17 49071160 missense possibly damaging 0.92
R3712:Lrfn2 UTSW 17 49071160 missense possibly damaging 0.92
R4521:Lrfn2 UTSW 17 49069894 start codon destroyed probably null 0.02
R4532:Lrfn2 UTSW 17 49070536 missense probably damaging 1.00
R4724:Lrfn2 UTSW 17 49070434 missense probably damaging 1.00
R5066:Lrfn2 UTSW 17 49096420 missense probably damaging 1.00
R5348:Lrfn2 UTSW 17 49096690 missense probably benign
R5673:Lrfn2 UTSW 17 49096597 missense probably benign 0.02
R5900:Lrfn2 UTSW 17 49070263 missense possibly damaging 0.82
R6014:Lrfn2 UTSW 17 49069906 missense possibly damaging 0.96
R6087:Lrfn2 UTSW 17 49071126 missense probably benign
R6224:Lrfn2 UTSW 17 49096351 missense probably damaging 1.00
R6229:Lrfn2 UTSW 17 49097132 missense possibly damaging 0.88
R6342:Lrfn2 UTSW 17 49097000 missense probably benign 0.27
R6408:Lrfn2 UTSW 17 49070626 missense probably damaging 1.00
R7026:Lrfn2 UTSW 17 49096977 missense probably benign 0.00
R7505:Lrfn2 UTSW 17 49096451 missense probably benign 0.14
R7852:Lrfn2 UTSW 17 49069944 missense possibly damaging 0.69
R7935:Lrfn2 UTSW 17 49069944 missense possibly damaging 0.69
Z1177:Lrfn2 UTSW 17 49070012
Z1177:Lrfn2 UTSW 17 49070095
Z1177:Lrfn2 UTSW 17 49096715
Predicted Primers PCR Primer
(F):5'- GCCTTTGAAGACTTCTTGCTGAC -3'
(R):5'- AGTAGCGACCCTTGAGACTTC -3'

Sequencing Primer
(F):5'- TGCTGACTTTAGAAGACCTGGACC -3'
(R):5'- GATCCACAGGTCTCCAGGTCATC -3'
Posted On2016-06-06