Incidental Mutation 'R5063:Casp8'
ID386724
Institutional Source Beutler Lab
Gene Symbol Casp8
Ensembl Gene ENSMUSG00000026029
Gene Namecaspase 8
SynonymsMACH, Mch5, FLICE, Caspase-8
MMRRC Submission 042653-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5063 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location58795374-58847503 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 58844374 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 280 (H280L)
Ref Sequence ENSEMBL: ENSMUSP00000127375 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027189] [ENSMUST00000165549] [ENSMUST00000190213] [ENSMUST00000191201]
Predicted Effect probably damaging
Transcript: ENSMUST00000027189
AA Change: H280L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000027189
Gene: ENSMUSG00000026029
AA Change: H280L

DomainStartEndE-ValueType
DED 1 80 3.21e-23 SMART
DED 99 178 1.01e-15 SMART
CASc 227 480 2.13e-110 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000165549
AA Change: H280L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000127375
Gene: ENSMUSG00000026029
AA Change: H280L

DomainStartEndE-ValueType
DED 1 80 3.21e-23 SMART
DED 99 178 1.01e-15 SMART
CASc 227 480 2.13e-110 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000190213
AA Change: H300L

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000140335
Gene: ENSMUSG00000026029
AA Change: H300L

DomainStartEndE-ValueType
DED 21 100 1.5e-25 SMART
DED 119 198 5e-18 SMART
CASc 247 500 1.1e-112 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000191201
AA Change: H300L

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000140546
Gene: ENSMUSG00000026029
AA Change: H300L

DomainStartEndE-ValueType
DED 21 100 1.5e-25 SMART
DED 119 198 5e-18 SMART
CASc 247 500 1.1e-112 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency
MGI Phenotype FUNCTION: This gene is part of a family of caspases, aspartate-specific cysteine proteases well studied for their involvement in immune and apoptosis signaling. This protein, an initiator of apoptotic cell death, is activated by death-inducing tumor necrosis family receptors and targets downstream effectors. In mouse deficiency of this gene can cause embryonic lethality. This protein may have a role in embryogenesis. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Apr 2013]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit impaired cardiac muscle development, cardiac erythrocyte congestion, low numbers of colony-forming cells, and prenatal lethality. T-cell restricted knockout mice are viable, but immunodeficient. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130011E15Rik A G 19: 45,885,955 I593T possibly damaging Het
Aatk T C 11: 120,010,489 H970R probably benign Het
Anapc1 T C 2: 128,629,549 M1496V possibly damaging Het
Arhgef4 A T 1: 34,724,215 T851S probably benign Het
Cacna1d A G 14: 30,051,383 S1782P probably benign Het
Capn13 T A 17: 73,322,079 R578* probably null Het
Cd274 G T 19: 29,384,143 D284Y probably damaging Het
Cenpe T A 3: 135,270,954 C2441S probably damaging Het
Chn2 A T 6: 54,290,287 K118* probably null Het
Chst12 G T 5: 140,524,412 E265* probably null Het
Cp C A 3: 19,989,215 Q22K probably benign Het
Diaph3 A T 14: 86,984,870 W404R probably damaging Het
Dnajb13 T G 7: 100,510,823 E69A probably damaging Het
Dzip1l A G 9: 99,667,652 E725G probably damaging Het
Dzip3 T A 16: 48,953,754 K373* probably null Het
Fmn1 C T 2: 113,364,921 T322I unknown Het
Gbp9 T C 5: 105,085,162 Y208C probably benign Het
Gtf2i T A 5: 134,260,571 K418N probably damaging Het
Herc3 C T 6: 58,855,760 Q137* probably null Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Iqcm A T 8: 75,746,286 D251V probably damaging Het
Itpr3 A T 17: 27,089,911 I363F possibly damaging Het
Khnyn A T 14: 55,887,203 K305* probably null Het
Klf17 A G 4: 117,760,659 V167A possibly damaging Het
Letm2 T C 8: 25,581,779 D369G probably benign Het
Lrrc31 A G 3: 30,689,936 V141A possibly damaging Het
Msh5 A T 17: 35,042,188 probably null Het
Neb G A 2: 52,223,212 probably benign Het
Olfr16 T A 1: 172,957,442 S216T possibly damaging Het
Olfr720 A T 14: 14,175,593 M163K probably damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Padi6 T C 4: 140,741,880 I50V probably benign Het
Pcdhb22 G T 18: 37,519,126 G216C probably damaging Het
Ppy A G 11: 102,100,699 Y5H probably benign Het
Psmc1 T C 12: 100,115,475 L112S probably damaging Het
Ptov1 A G 7: 44,865,602 I195T possibly damaging Het
Rassf10 C A 7: 112,954,424 D77E probably benign Het
Slc25a45 T C 19: 5,884,462 S153P possibly damaging Het
Slco1a5 G A 6: 142,259,065 R126C probably damaging Het
Srebf2 T C 15: 82,177,451 V366A probably benign Het
St6galnac5 T C 3: 152,981,135 S61G probably benign Het
Sult6b1 A T 17: 78,905,576 V82D probably benign Het
Tep1 A T 14: 50,850,627 C818S possibly damaging Het
Tex15 T G 8: 33,582,610 F2728L possibly damaging Het
Tm9sf2 T A 14: 122,145,146 F190Y probably damaging Het
Tmem175 T C 5: 108,646,432 L476P probably damaging Het
Tmprss11c T C 5: 86,237,830 K248R probably benign Het
Tnk2 T A 16: 32,670,850 F316I probably damaging Het
Vmn2r75 T A 7: 86,164,164 M477L probably benign Het
Vmn2r83 A C 10: 79,479,087 I390L probably benign Het
Vmn2r88 A G 14: 51,411,146 Y49C probably damaging Het
Zdhhc4 T A 5: 143,316,622 I318F probably damaging Het
Zmat4 A T 8: 23,748,441 D27V probably damaging Het
Other mutations in Casp8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00684:Casp8 APN 1 58827314 critical splice donor site probably null
IGL00825:Casp8 APN 1 58829006 missense probably benign 0.02
IGL02025:Casp8 APN 1 58824147 missense possibly damaging 0.81
IGL02549:Casp8 APN 1 58833766 missense probably benign
amontillado UTSW 1 58844770 missense probably damaging 1.00
Porto UTSW 1 58833698 missense possibly damaging 0.89
IGL02991:Casp8 UTSW 1 58827279 missense probably benign 0.00
R0609:Casp8 UTSW 1 58844792 missense probably benign 0.00
R0960:Casp8 UTSW 1 58829013 critical splice donor site probably null
R1433:Casp8 UTSW 1 58824124 missense probably damaging 1.00
R1505:Casp8 UTSW 1 58828922 missense probably damaging 0.99
R1506:Casp8 UTSW 1 58824196 missense probably damaging 0.97
R1596:Casp8 UTSW 1 58831674 splice site probably benign
R1674:Casp8 UTSW 1 58844416 missense probably damaging 1.00
R1676:Casp8 UTSW 1 58844416 missense probably damaging 1.00
R1981:Casp8 UTSW 1 58828962 splice site probably null
R3909:Casp8 UTSW 1 58844811 missense probably damaging 1.00
R3911:Casp8 UTSW 1 58833705 missense probably damaging 1.00
R4231:Casp8 UTSW 1 58844770 missense probably damaging 1.00
R4233:Casp8 UTSW 1 58844770 missense probably damaging 1.00
R4234:Casp8 UTSW 1 58844770 missense probably damaging 1.00
R4235:Casp8 UTSW 1 58833698 missense possibly damaging 0.89
R4236:Casp8 UTSW 1 58844770 missense probably damaging 1.00
R4917:Casp8 UTSW 1 58827218 missense probably damaging 1.00
R4918:Casp8 UTSW 1 58827218 missense probably damaging 1.00
R5092:Casp8 UTSW 1 58844676 missense possibly damaging 0.53
R5153:Casp8 UTSW 1 58844845 missense probably benign 0.00
R5964:Casp8 UTSW 1 58833736 missense possibly damaging 0.62
R5979:Casp8 UTSW 1 58828912 missense probably benign
R7602:Casp8 UTSW 1 58833739 missense probably benign 0.43
R7675:Casp8 UTSW 1 58823947 missense possibly damaging 0.69
R8272:Casp8 UTSW 1 58833742 missense probably damaging 0.96
R8714:Casp8 UTSW 1 58833653 missense possibly damaging 0.57
R8747:Casp8 UTSW 1 58844458 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGTTCCAGCTGGCAGTACAC -3'
(R):5'- AGGGCACTTTGAACCAGTG -3'

Sequencing Primer
(F):5'- TGGCAGTACACAGCACTTTCAG -3'
(R):5'- CACTTTGAACCAGTGAAGTAAGATG -3'
Posted On2016-06-06