Incidental Mutation 'R5063:Olfr16'
ID386725
Institutional Source Beutler Lab
Gene Symbol Olfr16
Ensembl Gene ENSMUSG00000037924
Gene Nameolfactory receptor 16
SynonymsMOR23, MOR267-13, GA_x6K02T2R7CC-893157-892228
MMRRC Submission 042653-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.147) question?
Stock #R5063 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location172950409-172958357 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 172957442 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 216 (S216T)
Ref Sequence ENSEMBL: ENSMUSP00000149249 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038432] [ENSMUST00000215254]
Predicted Effect possibly damaging
Transcript: ENSMUST00000038432
AA Change: S216T

PolyPhen 2 Score 0.480 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000041524
Gene: ENSMUSG00000037924
AA Change: S216T

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 7.5e-51 PFAM
Pfam:7tm_1 41 289 3.4e-22 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000215254
AA Change: S216T

PolyPhen 2 Score 0.480 (Sensitivity: 0.89; Specificity: 0.90)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130011E15Rik A G 19: 45,885,955 I593T possibly damaging Het
Aatk T C 11: 120,010,489 H970R probably benign Het
Anapc1 T C 2: 128,629,549 M1496V possibly damaging Het
Arhgef4 A T 1: 34,724,215 T851S probably benign Het
Cacna1d A G 14: 30,051,383 S1782P probably benign Het
Capn13 T A 17: 73,322,079 R578* probably null Het
Casp8 A T 1: 58,844,374 H280L probably damaging Het
Cd274 G T 19: 29,384,143 D284Y probably damaging Het
Cenpe T A 3: 135,270,954 C2441S probably damaging Het
Chn2 A T 6: 54,290,287 K118* probably null Het
Chst12 G T 5: 140,524,412 E265* probably null Het
Cp C A 3: 19,989,215 Q22K probably benign Het
Diaph3 A T 14: 86,984,870 W404R probably damaging Het
Dnajb13 T G 7: 100,510,823 E69A probably damaging Het
Dzip1l A G 9: 99,667,652 E725G probably damaging Het
Dzip3 T A 16: 48,953,754 K373* probably null Het
Fmn1 C T 2: 113,364,921 T322I unknown Het
Gbp9 T C 5: 105,085,162 Y208C probably benign Het
Gtf2i T A 5: 134,260,571 K418N probably damaging Het
Herc3 C T 6: 58,855,760 Q137* probably null Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Iqcm A T 8: 75,746,286 D251V probably damaging Het
Itpr3 A T 17: 27,089,911 I363F possibly damaging Het
Khnyn A T 14: 55,887,203 K305* probably null Het
Klf17 A G 4: 117,760,659 V167A possibly damaging Het
Letm2 T C 8: 25,581,779 D369G probably benign Het
Lrrc31 A G 3: 30,689,936 V141A possibly damaging Het
Msh5 A T 17: 35,042,188 probably null Het
Neb G A 2: 52,223,212 probably benign Het
Olfr720 A T 14: 14,175,593 M163K probably damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Padi6 T C 4: 140,741,880 I50V probably benign Het
Pcdhb22 G T 18: 37,519,126 G216C probably damaging Het
Ppy A G 11: 102,100,699 Y5H probably benign Het
Psmc1 T C 12: 100,115,475 L112S probably damaging Het
Ptov1 A G 7: 44,865,602 I195T possibly damaging Het
Rassf10 C A 7: 112,954,424 D77E probably benign Het
Slc25a45 T C 19: 5,884,462 S153P possibly damaging Het
Slco1a5 G A 6: 142,259,065 R126C probably damaging Het
Srebf2 T C 15: 82,177,451 V366A probably benign Het
St6galnac5 T C 3: 152,981,135 S61G probably benign Het
Sult6b1 A T 17: 78,905,576 V82D probably benign Het
Tep1 A T 14: 50,850,627 C818S possibly damaging Het
Tex15 T G 8: 33,582,610 F2728L possibly damaging Het
Tm9sf2 T A 14: 122,145,146 F190Y probably damaging Het
Tmem175 T C 5: 108,646,432 L476P probably damaging Het
Tmprss11c T C 5: 86,237,830 K248R probably benign Het
Tnk2 T A 16: 32,670,850 F316I probably damaging Het
Vmn2r75 T A 7: 86,164,164 M477L probably benign Het
Vmn2r83 A C 10: 79,479,087 I390L probably benign Het
Vmn2r88 A G 14: 51,411,146 Y49C probably damaging Het
Zdhhc4 T A 5: 143,316,622 I318F probably damaging Het
Zmat4 A T 8: 23,748,441 D27V probably damaging Het
Other mutations in Olfr16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00334:Olfr16 APN 1 172957591 missense possibly damaging 0.66
IGL00336:Olfr16 APN 1 172957478 missense probably benign 0.30
IGL01155:Olfr16 APN 1 172956924 missense probably benign 0.43
IGL01549:Olfr16 APN 1 172956974 missense probably damaging 1.00
IGL02679:Olfr16 APN 1 172957176 missense probably damaging 1.00
IGL03071:Olfr16 APN 1 172956935 missense probably benign 0.01
IGL03352:Olfr16 APN 1 172957283 missense probably benign 0.00
R0449:Olfr16 UTSW 1 172957398 missense probably damaging 1.00
R1725:Olfr16 UTSW 1 172957341 missense possibly damaging 0.90
R1726:Olfr16 UTSW 1 172957091 missense probably benign 0.00
R1735:Olfr16 UTSW 1 172956807 missense probably benign
R1928:Olfr16 UTSW 1 172957314 missense probably damaging 0.98
R4258:Olfr16 UTSW 1 172957638 missense possibly damaging 0.88
R4359:Olfr16 UTSW 1 172957080 missense probably benign
R4434:Olfr16 UTSW 1 172957544 missense probably damaging 1.00
R4666:Olfr16 UTSW 1 172957590 missense probably benign
R4874:Olfr16 UTSW 1 172957599 missense probably benign 0.00
R5988:Olfr16 UTSW 1 172957156 nonsense probably null
R6074:Olfr16 UTSW 1 172957378 missense probably benign 0.10
R7021:Olfr16 UTSW 1 172956927 missense probably benign 0.01
R7234:Olfr16 UTSW 1 172957106 missense probably damaging 0.96
R7527:Olfr16 UTSW 1 172956944 missense probably benign 0.00
Z1088:Olfr16 UTSW 1 172957324 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCCAGCCATGTTCCATTTG -3'
(R):5'- TGTTCCTGAGGCTGTAGACAAC -3'

Sequencing Primer
(F):5'- GCCCTTTTGTGGCACGG -3'
(R):5'- GTCACAGAGAGAAGAAGGTCTTTTTC -3'
Posted On2016-06-06