Incidental Mutation 'R5063:Anapc1'
ID386730
Institutional Source Beutler Lab
Gene Symbol Anapc1
Ensembl Gene ENSMUSG00000014355
Gene Nameanaphase promoting complex subunit 1
Synonyms2610021O03Rik, tsg24, Apc1, Mcpr
MMRRC Submission 042653-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5063 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location128610104-128687391 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 128629549 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 1496 (M1496V)
Ref Sequence ENSEMBL: ENSMUSP00000014499 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014499]
Predicted Effect possibly damaging
Transcript: ENSMUST00000014499
AA Change: M1496V

PolyPhen 2 Score 0.482 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000014499
Gene: ENSMUSG00000014355
AA Change: M1496V

DomainStartEndE-ValueType
Pfam:ANAPC1 150 214 1.7e-13 PFAM
low complexity region 323 345 N/A INTRINSIC
low complexity region 1404 1415 N/A INTRINSIC
Pfam:PC_rep 1467 1501 8.3e-8 PFAM
low complexity region 1516 1528 N/A INTRINSIC
low complexity region 1924 1936 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145906
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154320
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154995
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the anaphase-promoting complex. This complex is an E3 ubiquitin ligase that regulates progression through the metaphase to anaphase portion of the cell cycle by ubiquitinating proteins which targets them for degradation. [provided by RefSeq, Dec 2011]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130011E15Rik A G 19: 45,885,955 I593T possibly damaging Het
Aatk T C 11: 120,010,489 H970R probably benign Het
Arhgef4 A T 1: 34,724,215 T851S probably benign Het
Cacna1d A G 14: 30,051,383 S1782P probably benign Het
Capn13 T A 17: 73,322,079 R578* probably null Het
Casp8 A T 1: 58,844,374 H280L probably damaging Het
Cd274 G T 19: 29,384,143 D284Y probably damaging Het
Cenpe T A 3: 135,270,954 C2441S probably damaging Het
Chn2 A T 6: 54,290,287 K118* probably null Het
Chst12 G T 5: 140,524,412 E265* probably null Het
Cp C A 3: 19,989,215 Q22K probably benign Het
Diaph3 A T 14: 86,984,870 W404R probably damaging Het
Dnajb13 T G 7: 100,510,823 E69A probably damaging Het
Dzip1l A G 9: 99,667,652 E725G probably damaging Het
Dzip3 T A 16: 48,953,754 K373* probably null Het
Fmn1 C T 2: 113,364,921 T322I unknown Het
Gbp9 T C 5: 105,085,162 Y208C probably benign Het
Gtf2i T A 5: 134,260,571 K418N probably damaging Het
Herc3 C T 6: 58,855,760 Q137* probably null Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Iqcm A T 8: 75,746,286 D251V probably damaging Het
Itpr3 A T 17: 27,089,911 I363F possibly damaging Het
Khnyn A T 14: 55,887,203 K305* probably null Het
Klf17 A G 4: 117,760,659 V167A possibly damaging Het
Letm2 T C 8: 25,581,779 D369G probably benign Het
Lrrc31 A G 3: 30,689,936 V141A possibly damaging Het
Msh5 A T 17: 35,042,188 probably null Het
Neb G A 2: 52,223,212 probably benign Het
Olfr16 T A 1: 172,957,442 S216T possibly damaging Het
Olfr720 A T 14: 14,175,593 M163K probably damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Padi6 T C 4: 140,741,880 I50V probably benign Het
Pcdhb22 G T 18: 37,519,126 G216C probably damaging Het
Ppy A G 11: 102,100,699 Y5H probably benign Het
Psmc1 T C 12: 100,115,475 L112S probably damaging Het
Ptov1 A G 7: 44,865,602 I195T possibly damaging Het
Rassf10 C A 7: 112,954,424 D77E probably benign Het
Slc25a45 T C 19: 5,884,462 S153P possibly damaging Het
Slco1a5 G A 6: 142,259,065 R126C probably damaging Het
Srebf2 T C 15: 82,177,451 V366A probably benign Het
St6galnac5 T C 3: 152,981,135 S61G probably benign Het
Sult6b1 A T 17: 78,905,576 V82D probably benign Het
Tep1 A T 14: 50,850,627 C818S possibly damaging Het
Tex15 T G 8: 33,582,610 F2728L possibly damaging Het
Tm9sf2 T A 14: 122,145,146 F190Y probably damaging Het
Tmem175 T C 5: 108,646,432 L476P probably damaging Het
Tmprss11c T C 5: 86,237,830 K248R probably benign Het
Tnk2 T A 16: 32,670,850 F316I probably damaging Het
Vmn2r75 T A 7: 86,164,164 M477L probably benign Het
Vmn2r83 A C 10: 79,479,087 I390L probably benign Het
Vmn2r88 A G 14: 51,411,146 Y49C probably damaging Het
Zdhhc4 T A 5: 143,316,622 I318F probably damaging Het
Zmat4 A T 8: 23,748,441 D27V probably damaging Het
Other mutations in Anapc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00232:Anapc1 APN 2 128645130 splice site probably benign
IGL00704:Anapc1 APN 2 128663984 missense possibly damaging 0.48
IGL01023:Anapc1 APN 2 128629729 missense probably damaging 1.00
IGL01432:Anapc1 APN 2 128633408 missense probably damaging 1.00
IGL01549:Anapc1 APN 2 128653170 missense probably benign
IGL02089:Anapc1 APN 2 128663933 missense probably damaging 1.00
IGL02275:Anapc1 APN 2 128659852 missense probably benign
IGL02570:Anapc1 APN 2 128645200 missense probably damaging 1.00
IGL02597:Anapc1 APN 2 128623931 missense probably benign 0.02
IGL02726:Anapc1 APN 2 128659785 missense probably benign 0.05
IGL03265:Anapc1 APN 2 128627197 missense probably damaging 1.00
IGL03304:Anapc1 APN 2 128627113 splice site probably benign
IGL03327:Anapc1 APN 2 128623934 missense probably benign 0.00
R0023:Anapc1 UTSW 2 128678218 missense probably damaging 0.99
R0027:Anapc1 UTSW 2 128641511 missense possibly damaging 0.96
R0027:Anapc1 UTSW 2 128641511 missense possibly damaging 0.96
R0084:Anapc1 UTSW 2 128623966 splice site probably benign
R0103:Anapc1 UTSW 2 128680452 splice site probably benign
R0103:Anapc1 UTSW 2 128680452 splice site probably benign
R0109:Anapc1 UTSW 2 128634693 missense probably damaging 1.00
R0109:Anapc1 UTSW 2 128634693 missense probably damaging 1.00
R0241:Anapc1 UTSW 2 128628629 missense possibly damaging 0.89
R0241:Anapc1 UTSW 2 128628629 missense possibly damaging 0.89
R0255:Anapc1 UTSW 2 128634711 missense probably damaging 0.99
R0377:Anapc1 UTSW 2 128641340 critical splice donor site probably null
R0467:Anapc1 UTSW 2 128669043 missense probably damaging 0.99
R0514:Anapc1 UTSW 2 128632655 missense probably damaging 0.99
R0591:Anapc1 UTSW 2 128619332 missense probably benign 0.17
R0919:Anapc1 UTSW 2 128617731 missense probably benign
R1175:Anapc1 UTSW 2 128680188 missense probably damaging 1.00
R1473:Anapc1 UTSW 2 128617697 missense possibly damaging 0.88
R1547:Anapc1 UTSW 2 128617556 missense probably benign 0.44
R1556:Anapc1 UTSW 2 128624899 missense probably benign 0.00
R1567:Anapc1 UTSW 2 128617716 missense probably damaging 1.00
R1635:Anapc1 UTSW 2 128628532 missense probably damaging 1.00
R1645:Anapc1 UTSW 2 128658246 critical splice donor site probably null
R1677:Anapc1 UTSW 2 128676208 missense probably benign 0.09
R1854:Anapc1 UTSW 2 128675890 missense probably damaging 1.00
R1856:Anapc1 UTSW 2 128659788 missense probably damaging 0.96
R1959:Anapc1 UTSW 2 128633415 missense probably benign 0.36
R1984:Anapc1 UTSW 2 128669688 missense possibly damaging 0.85
R2034:Anapc1 UTSW 2 128648458 missense possibly damaging 0.92
R2283:Anapc1 UTSW 2 128642548 missense probably benign 0.23
R2928:Anapc1 UTSW 2 128680137 missense probably damaging 1.00
R3547:Anapc1 UTSW 2 128642682 missense possibly damaging 0.58
R3904:Anapc1 UTSW 2 128642519 missense probably damaging 1.00
R4156:Anapc1 UTSW 2 128627229 intron probably benign
R4359:Anapc1 UTSW 2 128623556 missense possibly damaging 0.64
R4392:Anapc1 UTSW 2 128676249 critical splice acceptor site probably null
R4574:Anapc1 UTSW 2 128627195 missense probably damaging 1.00
R4682:Anapc1 UTSW 2 128664005 missense probably benign 0.05
R4770:Anapc1 UTSW 2 128686060 splice site probably benign
R4824:Anapc1 UTSW 2 128628690 missense possibly damaging 0.69
R4960:Anapc1 UTSW 2 128684594 missense probably benign 0.23
R5016:Anapc1 UTSW 2 128607175 unclassified probably benign
R5128:Anapc1 UTSW 2 128659917 missense probably benign
R5271:Anapc1 UTSW 2 128685985 nonsense probably null
R5363:Anapc1 UTSW 2 128650194 critical splice donor site probably null
R5469:Anapc1 UTSW 2 128675701 nonsense probably null
R5473:Anapc1 UTSW 2 128607195 unclassified probably benign
R5559:Anapc1 UTSW 2 128680434 nonsense probably null
R5631:Anapc1 UTSW 2 128657217 missense possibly damaging 0.85
R5747:Anapc1 UTSW 2 128624916 missense probably benign 0.19
R5840:Anapc1 UTSW 2 128607037 unclassified probably benign
R6226:Anapc1 UTSW 2 128650372 missense probably damaging 1.00
R6526:Anapc1 UTSW 2 128672135 nonsense probably null
R6561:Anapc1 UTSW 2 128663999 missense probably damaging 0.98
R6743:Anapc1 UTSW 2 128684534 nonsense probably null
R6799:Anapc1 UTSW 2 128659737 missense probably null 0.38
R6887:Anapc1 UTSW 2 128659768 missense possibly damaging 0.91
R6978:Anapc1 UTSW 2 128669900 missense probably benign 0.06
R7011:Anapc1 UTSW 2 128648681 intron probably null
R7041:Anapc1 UTSW 2 128628656 missense possibly damaging 0.88
R7047:Anapc1 UTSW 2 128615430 missense probably damaging 0.96
R7074:Anapc1 UTSW 2 128678274 missense probably damaging 1.00
R7109:Anapc1 UTSW 2 128674602 missense probably benign 0.33
R7123:Anapc1 UTSW 2 128613010 missense probably damaging 1.00
R7309:Anapc1 UTSW 2 128674684 missense probably damaging 0.96
R7693:Anapc1 UTSW 2 128641537 missense possibly damaging 0.86
R7839:Anapc1 UTSW 2 128684608 missense probably damaging 0.99
R7847:Anapc1 UTSW 2 128669908 missense possibly damaging 0.93
R7922:Anapc1 UTSW 2 128684608 missense probably damaging 0.99
R7930:Anapc1 UTSW 2 128669908 missense possibly damaging 0.93
R8061:Anapc1 UTSW 2 128648488 missense probably damaging 0.98
X0066:Anapc1 UTSW 2 128674701 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- GCACAAAGAGAACAGTGCTTC -3'
(R):5'- TTTCAGGCAAGCACACGTC -3'

Sequencing Primer
(F):5'- GAGAACAGTGCTTCAAACCTTG -3'
(R):5'- TACATCATTGCAGGAGCCTG -3'
Posted On2016-06-06