Mutagenetix > Incidental Mutations

Incidental Mutation 'R5063:Anapc1'

386730

Institutional Source

Beutler Lab

Gene Symbol

Anapc1

Ensembl Gene

ENSMUSG00000014355

Gene Name

anaphase promoting complex subunit 1

Synonyms

2610021O03Rik, tsg24, Apc1, Mcpr

MMRRC Submission

042653-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R5063 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

128610104-128687391 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 128629549 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Valine at position 1496 (M1496V)

Ref Sequence

ENSEMBL: ENSMUSP00000014499 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000014499]

AlphaFold

P53995

Predicted Effect

possibly damaging
Transcript: ENSMUST00000014499
AA Change: M1496V

PolyPhen 2 Score 0.482 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000014499
Gene: ENSMUSG00000014355
AA Change: M1496V

Domain	Start	End	E-Value	Type
Pfam:ANAPC1	150	214	1.7e-13	PFAM
low complexity region	323	345	N/A	INTRINSIC
low complexity region	1404	1415	N/A	INTRINSIC
Pfam:PC_rep	1467	1501	8.3e-8	PFAM
low complexity region	1516	1528	N/A	INTRINSIC
low complexity region	1924	1936	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000145906

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000154320

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000154995

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.6%
20x: 93.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the anaphase-promoting complex. This complex is an E3 ubiquitin ligase that regulates progression through the metaphase to anaphase portion of the cell cycle by ubiquitinating proteins which targets them for degradation. [provided by RefSeq, Dec 2011]

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9130011E15Rik	A	G	19: 45,885,955	I593T	possibly damaging	Het
Aatk	T	C	11: 120,010,489	H970R	probably benign	Het
Arhgef4	A	T	1: 34,724,215	T851S	probably benign	Het
Cacna1d	A	G	14: 30,051,383	S1782P	probably benign	Het
Capn13	T	A	17: 73,322,079	R578*	probably null	Het
Casp8	A	T	1: 58,844,374	H280L	probably damaging	Het
Cd274	G	T	19: 29,384,143	D284Y	probably damaging	Het
Cenpe	T	A	3: 135,270,954	C2441S	probably damaging	Het
Chn2	A	T	6: 54,290,287	K118*	probably null	Het
Chst12	G	T	5: 140,524,412	E265*	probably null	Het
Cp	C	A	3: 19,989,215	Q22K	probably benign	Het
Diaph3	A	T	14: 86,984,870	W404R	probably damaging	Het
Dnajb13	T	G	7: 100,510,823	E69A	probably damaging	Het
Dzip1l	A	G	9: 99,667,652	E725G	probably damaging	Het
Dzip3	T	A	16: 48,953,754	K373*	probably null	Het
Fmn1	C	T	2: 113,364,921	T322I	unknown	Het
Gbp9	T	C	5: 105,085,162	Y208C	probably benign	Het
Gtf2i	T	A	5: 134,260,571	K418N	probably damaging	Het
Herc3	C	T	6: 58,855,760	Q137*	probably null	Het
Igkv4-80	A	C	6: 69,016,665	S81A	probably benign	Het
Iqcm	A	T	8: 75,746,286	D251V	probably damaging	Het
Itpr3	A	T	17: 27,089,911	I363F	possibly damaging	Het
Khnyn	A	T	14: 55,887,203	K305*	probably null	Het
Klf17	A	G	4: 117,760,659	V167A	possibly damaging	Het
Letm2	T	C	8: 25,581,779	D369G	probably benign	Het
Lrrc31	A	G	3: 30,689,936	V141A	possibly damaging	Het
Msh5	A	T	17: 35,042,188		probably null	Het
Neb	G	A	2: 52,223,212		probably benign	Het
Olfr16	T	A	1: 172,957,442	S216T	possibly damaging	Het
Olfr720	A	T	14: 14,175,593	M163K	probably damaging	Het
Otx1	C	A	11: 21,997,037	A91S	probably damaging	Het
Padi6	T	C	4: 140,741,880	I50V	probably benign	Het
Pcdhb22	G	T	18: 37,519,126	G216C	probably damaging	Het
Ppy	A	G	11: 102,100,699	Y5H	probably benign	Het
Psmc1	T	C	12: 100,115,475	L112S	probably damaging	Het
Ptov1	A	G	7: 44,865,602	I195T	possibly damaging	Het
Rassf10	C	A	7: 112,954,424	D77E	probably benign	Het
Slc25a45	T	C	19: 5,884,462	S153P	possibly damaging	Het
Slco1a5	G	A	6: 142,259,065	R126C	probably damaging	Het
Srebf2	T	C	15: 82,177,451	V366A	probably benign	Het
St6galnac5	T	C	3: 152,981,135	S61G	probably benign	Het
Sult6b1	A	T	17: 78,905,576	V82D	probably benign	Het
Tep1	A	T	14: 50,850,627	C818S	possibly damaging	Het
Tex15	T	G	8: 33,582,610	F2728L	possibly damaging	Het
Tm9sf2	T	A	14: 122,145,146	F190Y	probably damaging	Het
Tmem175	T	C	5: 108,646,432	L476P	probably damaging	Het
Tmprss11c	T	C	5: 86,237,830	K248R	probably benign	Het
Tnk2	T	A	16: 32,670,850	F316I	probably damaging	Het
Vmn2r75	T	A	7: 86,164,164	M477L	probably benign	Het
Vmn2r83	A	C	10: 79,479,087	I390L	probably benign	Het
Vmn2r88	A	G	14: 51,411,146	Y49C	probably damaging	Het
Zdhhc4	T	A	5: 143,316,622	I318F	probably damaging	Het
Zmat4	A	T	8: 23,748,441	D27V	probably damaging	Het

Other mutations in Anapc1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00232:Anapc1	APN	2	128645130	splice site	probably benign
IGL00704:Anapc1	APN	2	128663984	missense	possibly damaging	0.48
IGL01023:Anapc1	APN	2	128629729	missense	probably damaging	1.00
IGL01432:Anapc1	APN	2	128633408	missense	probably damaging	1.00
IGL01549:Anapc1	APN	2	128653170	missense	probably benign
IGL02089:Anapc1	APN	2	128663933	missense	probably damaging	1.00
IGL02275:Anapc1	APN	2	128659852	missense	probably benign
IGL02570:Anapc1	APN	2	128645200	missense	probably damaging	1.00
IGL02597:Anapc1	APN	2	128623931	missense	probably benign	0.02
IGL02726:Anapc1	APN	2	128659785	missense	probably benign	0.05
IGL03265:Anapc1	APN	2	128627197	missense	probably damaging	1.00
IGL03304:Anapc1	APN	2	128627113	splice site	probably benign
IGL03327:Anapc1	APN	2	128623934	missense	probably benign	0.00
R0023:Anapc1	UTSW	2	128678218	missense	probably damaging	0.99
R0027:Anapc1	UTSW	2	128641511	missense	possibly damaging	0.96
R0027:Anapc1	UTSW	2	128641511	missense	possibly damaging	0.96
R0084:Anapc1	UTSW	2	128623966	splice site	probably benign
R0103:Anapc1	UTSW	2	128680452	splice site	probably benign
R0103:Anapc1	UTSW	2	128680452	splice site	probably benign
R0109:Anapc1	UTSW	2	128634693	missense	probably damaging	1.00
R0109:Anapc1	UTSW	2	128634693	missense	probably damaging	1.00
R0241:Anapc1	UTSW	2	128628629	missense	possibly damaging	0.89
R0241:Anapc1	UTSW	2	128628629	missense	possibly damaging	0.89
R0255:Anapc1	UTSW	2	128634711	missense	probably damaging	0.99
R0377:Anapc1	UTSW	2	128641340	critical splice donor site	probably null
R0467:Anapc1	UTSW	2	128669043	missense	probably damaging	0.99
R0514:Anapc1	UTSW	2	128632655	missense	probably damaging	0.99
R0591:Anapc1	UTSW	2	128619332	missense	probably benign	0.17
R0919:Anapc1	UTSW	2	128617731	missense	probably benign
R1175:Anapc1	UTSW	2	128680188	missense	probably damaging	1.00
R1473:Anapc1	UTSW	2	128617697	missense	possibly damaging	0.88
R1547:Anapc1	UTSW	2	128617556	missense	probably benign	0.44
R1556:Anapc1	UTSW	2	128624899	missense	probably benign	0.00
R1567:Anapc1	UTSW	2	128617716	missense	probably damaging	1.00
R1635:Anapc1	UTSW	2	128628532	missense	probably damaging	1.00
R1645:Anapc1	UTSW	2	128658246	critical splice donor site	probably null
R1677:Anapc1	UTSW	2	128676208	missense	probably benign	0.09
R1854:Anapc1	UTSW	2	128675890	missense	probably damaging	1.00
R1856:Anapc1	UTSW	2	128659788	missense	probably damaging	0.96
R1959:Anapc1	UTSW	2	128633415	missense	probably benign	0.36
R1984:Anapc1	UTSW	2	128669688	missense	possibly damaging	0.85
R2034:Anapc1	UTSW	2	128648458	missense	possibly damaging	0.92
R2283:Anapc1	UTSW	2	128642548	missense	probably benign	0.23
R2928:Anapc1	UTSW	2	128680137	missense	probably damaging	1.00
R3547:Anapc1	UTSW	2	128642682	missense	possibly damaging	0.58
R3904:Anapc1	UTSW	2	128642519	missense	probably damaging	1.00
R4156:Anapc1	UTSW	2	128627229	intron	probably benign
R4359:Anapc1	UTSW	2	128623556	missense	possibly damaging	0.64
R4392:Anapc1	UTSW	2	128676249	critical splice acceptor site	probably null
R4574:Anapc1	UTSW	2	128627195	missense	probably damaging	1.00
R4682:Anapc1	UTSW	2	128664005	missense	probably benign	0.05
R4770:Anapc1	UTSW	2	128686060	splice site	probably benign
R4824:Anapc1	UTSW	2	128628690	missense	possibly damaging	0.69
R4960:Anapc1	UTSW	2	128684594	missense	probably benign	0.23
R5016:Anapc1	UTSW	2	128607175	unclassified	probably benign
R5128:Anapc1	UTSW	2	128659917	missense	probably benign
R5271:Anapc1	UTSW	2	128685985	nonsense	probably null
R5363:Anapc1	UTSW	2	128650194	critical splice donor site	probably null
R5469:Anapc1	UTSW	2	128675701	nonsense	probably null
R5473:Anapc1	UTSW	2	128607195	unclassified	probably benign
R5559:Anapc1	UTSW	2	128680434	nonsense	probably null
R5631:Anapc1	UTSW	2	128657217	missense	possibly damaging	0.85
R5747:Anapc1	UTSW	2	128624916	missense	probably benign	0.19
R5840:Anapc1	UTSW	2	128607037	unclassified	probably benign
R6226:Anapc1	UTSW	2	128650372	missense	probably damaging	1.00
R6526:Anapc1	UTSW	2	128672135	nonsense	probably null
R6561:Anapc1	UTSW	2	128663999	missense	probably damaging	0.98
R6743:Anapc1	UTSW	2	128684534	nonsense	probably null
R6799:Anapc1	UTSW	2	128659737	missense	probably null	0.38
R6887:Anapc1	UTSW	2	128659768	missense	possibly damaging	0.91
R6978:Anapc1	UTSW	2	128669900	missense	probably benign	0.06
R7011:Anapc1	UTSW	2	128648681	splice site	probably null
R7041:Anapc1	UTSW	2	128628656	missense	possibly damaging	0.88
R7047:Anapc1	UTSW	2	128615430	missense	probably damaging	0.96
R7074:Anapc1	UTSW	2	128678274	missense	probably damaging	1.00
R7109:Anapc1	UTSW	2	128674602	missense	probably benign	0.33
R7123:Anapc1	UTSW	2	128613010	missense	probably damaging	1.00
R7309:Anapc1	UTSW	2	128674684	missense	probably damaging	0.96
R7693:Anapc1	UTSW	2	128641537	missense	possibly damaging	0.86
R7839:Anapc1	UTSW	2	128684608	missense	probably damaging	0.99
R7847:Anapc1	UTSW	2	128669908	missense	possibly damaging	0.93
R7960:Anapc1	UTSW	2	128674593	missense	probably damaging	1.00
R8061:Anapc1	UTSW	2	128648488	missense	probably damaging	0.98
R8127:Anapc1	UTSW	2	128632627	missense	probably damaging	0.96
R8228:Anapc1	UTSW	2	128619917	nonsense	probably null
R8402:Anapc1	UTSW	2	128630228	missense	probably benign	0.02
R8422:Anapc1	UTSW	2	128675837	missense	probably benign
R8425:Anapc1	UTSW	2	128669868	missense	probably damaging	1.00
R8469:Anapc1	UTSW	2	128658344	splice site	probably null
R8553:Anapc1	UTSW	2	128619913	missense	possibly damaging	0.80
R8688:Anapc1	UTSW	2	128685828	missense	probably benign	0.19
R8699:Anapc1	UTSW	2	128641453	missense	probably damaging	1.00
R8719:Anapc1	UTSW	2	128641449	missense	probably damaging	1.00
R8775:Anapc1	UTSW	2	128657173	missense	possibly damaging	0.92
R8775-TAIL:Anapc1	UTSW	2	128657173	missense	possibly damaging	0.92
R8806:Anapc1	UTSW	2	128622413	missense	possibly damaging	0.67
R8973:Anapc1	UTSW	2	128664032	missense	probably damaging	0.99
R8977:Anapc1	UTSW	2	128641402	missense	probably damaging	1.00
R9000:Anapc1	UTSW	2	128634708	missense	probably damaging	1.00
R9080:Anapc1	UTSW	2	128622506	missense	possibly damaging	0.82
R9203:Anapc1	UTSW	2	128623502	missense	possibly damaging	0.66
R9314:Anapc1	UTSW	2	128622500	missense	possibly damaging	0.69
R9386:Anapc1	UTSW	2	128617722	missense	probably benign	0.08
R9415:Anapc1	UTSW	2	128634678	missense	probably benign
R9436:Anapc1	UTSW	2	128676125	missense	probably benign
X0066:Anapc1	UTSW	2	128674701	missense	probably benign	0.10

Predicted Primers

PCR Primer
(F):5'- GCACAAAGAGAACAGTGCTTC -3'
(R):5'- TTTCAGGCAAGCACACGTC -3'

Sequencing Primer
(F):5'- GAGAACAGTGCTTCAAACCTTG -3'
(R):5'- TACATCATTGCAGGAGCCTG -3'

Posted On

2016-06-06