Mutagenetix > Incidental Mutations

Incidental Mutation 'R0426:Dicer1'

38674

Institutional Source

Beutler Lab

Gene Symbol

Dicer1

Ensembl Gene

ENSMUSG00000041415

Gene Name

dicer 1, ribonuclease type III

Synonyms

D12Ertd7e

MMRRC Submission

038628-MU

Accession Numbers

Ncbi RefSeq: NM_148948.2; MGI:2177178

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R0426 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

104687742-104751952 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 104702542 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 1294 (S1294P)

Ref Sequence

ENSEMBL: ENSMUSP00000043676 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041987]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000041987
AA Change: S1294P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000043676
Gene: ENSMUSG00000041415
AA Change: S1294P

Domain	Start	End	E-Value	Type
DEXDc	30	233	5.14e-24	SMART
low complexity region	403	419	N/A	INTRINSIC
HELICc	449	546	3.15e-10	SMART
Pfam:Dicer_dimer	620	707	1.4e-25	PFAM
low complexity region	713	723	N/A	INTRINSIC
PAZ	881	1056	1.67e-48	SMART
Blast:PAZ	1080	1129	2e-8	BLAST
RIBOc	1285	1582	1.83e-35	SMART
RIBOc	1665	1831	5.97e-49	SMART
DSRM	1834	1897	6.89e-9	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000222115

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000222519

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000222528

Meta Mutation Damage Score

0.4785

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.7%
20x: 93.9%

Validation Efficiency

96% (86/90)

MGI Phenotype

Strain: 3589209; 3809262; 2681012; 3576927
Lethality: E7-E14
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein possessing an RNA helicase motif containing a DEXH box in its amino terminus and an RNA motif in the carboxy terminus. The encoded protein functions as a ribonuclease and is required by the RNA interference and small temporal RNA (stRNA) pathways to produce the active small RNA component that represses gene expression. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2010]
PHENOTYPE: Mutation of this locus results in arrest of early embryonic development. [provided by MGI curators]

Allele List at MGI

All alleles(25) : Targeted(14) Gene trapped(11)

Other mutations in this stock

Total: 87 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A830010M20Rik	C	T	5: 107,510,373	T1603I	probably damaging	Het
Abca8b	G	T	11: 109,955,027		probably benign	Het
Acadl	A	T	1: 66,841,646	F320L	probably damaging	Het
Acsbg1	T	C	9: 54,622,746	D222G	probably benign	Het
Anapc15	A	G	7: 101,898,033	T39A	probably benign	Het
Ano3	A	T	2: 110,661,174	V919E	probably damaging	Het
Arhgef12	T	C	9: 42,970,990		probably null	Het
Atad5	T	A	11: 80,112,832	I1091N	probably benign	Het
Atf1	A	T	15: 100,232,827	H26L	possibly damaging	Het
Atp10a	T	C	7: 58,784,734	M252T	probably benign	Het
Cd55	C	T	1: 130,448,372	R347H	probably benign	Het
Cdc27	A	C	11: 104,513,027		probably null	Het
Cdh9	G	A	15: 16,823,454		probably null	Het
Cdk11b	T	C	4: 155,642,512		probably benign	Het
Cep70	A	G	9: 99,297,684	D567G	probably benign	Het
Cep78	A	T	19: 15,970,970	Y382*	probably null	Het
Col9a2	T	C	4: 121,044,660		probably benign	Het
Cyp2d12	G	A	15: 82,558,963	D409N	probably benign	Het
Ddx39	A	G	8: 83,721,769	T217A	probably benign	Het
Dennd1b	T	A	1: 139,170,196	D733E	probably benign	Het
Dnah3	T	C	7: 119,943,572	E3539G	probably benign	Het
Dnmbp	A	G	19: 43,852,436		probably benign	Het
Dysf	T	C	6: 84,149,757	L1332P	probably damaging	Het
F5	A	G	1: 164,182,840	D380G	probably damaging	Het
Fam160a2	A	C	7: 105,389,473	C186W	probably damaging	Het
Fam171a1	T	C	2: 3,225,396	V522A	probably benign	Het
Galr2	C	A	11: 116,281,691	A69D	probably damaging	Het
Grk2	T	C	19: 4,290,600		probably null	Het
Gtf3c1	A	T	7: 125,663,016	Y1119*	probably null	Het
Hgd	A	T	16: 37,588,685		probably benign	Het
Ildr2	G	T	1: 166,308,899	V436L	probably benign	Het
Intu	G	A	3: 40,675,305	C355Y	probably damaging	Het
Irf2bpl	G	T	12: 86,883,096	P268T	probably benign	Het
Jarid2	T	C	13: 44,840,882		probably null	Het
Jup	A	T	11: 100,372,401	M716K	probably benign	Het
Kank1	G	A	19: 25,411,473	V809I	probably damaging	Het
Kdm1b	T	A	13: 47,064,244		probably benign	Het
Kdm3a	C	T	6: 71,600,755	C687Y	probably damaging	Het
Kdm5d	T	A	Y: 942,437		probably benign	Het
Kifap3	T	A	1: 163,865,552		probably benign	Het
Macf1	T	A	4: 123,483,660	K1400*	probably null	Het
Majin	A	G	19: 6,212,117		probably benign	Het
Mb21d1	G	A	9: 78,435,738		probably benign	Het
Mctp1	A	G	13: 77,020,821	I846V	probably benign	Het
Mrgpra2b	T	A	7: 47,464,127	I286F	possibly damaging	Het
Neil3	T	G	8: 53,609,396		probably benign	Het
Nox3	G	T	17: 3,695,563	N23K	probably damaging	Het
Nt5c3	T	C	6: 56,883,812	K219E	probably benign	Het
Olfr1458	G	A	19: 13,103,278	R3C	possibly damaging	Het
Olfr213	A	T	6: 116,540,485	N11Y	probably damaging	Het
Olfr389	T	A	11: 73,776,437	M297L	probably benign	Het
Olfr524	A	C	7: 140,202,116	F218C	possibly damaging	Het
Olfr548-ps1	T	A	7: 102,542,686	I250N	probably damaging	Het
Olfr954	T	C	9: 39,461,593	L54P	probably damaging	Het
Pacsin2	A	G	15: 83,379,795	V347A	possibly damaging	Het
Pcdhb7	A	T	18: 37,342,804	E331V	probably damaging	Het
Pcid2	A	C	8: 13,081,262		probably null	Het
Pcsk9	T	C	4: 106,450,077	D323G	possibly damaging	Het
Pdhb	T	C	14: 8,169,801	E203G	probably damaging	Het
Phlpp2	A	G	8: 109,928,463	Y630C	probably benign	Het
Pidd1	C	T	7: 141,439,133	A812T	probably damaging	Het
Plau	G	A	14: 20,842,314	R389H	probably benign	Het
Plekhg6	G	A	6: 125,364,629		probably null	Het
Ppox	T	C	1: 171,277,749	Y321C	probably damaging	Het
Pxdn	A	G	12: 29,987,066	N281S	possibly damaging	Het
Pycrl	A	T	15: 75,918,388	M138K	probably benign	Het
Radil	T	C	5: 142,497,873	Y526C	probably damaging	Het
Ranbp3	C	A	17: 56,707,169	D233E	probably benign	Het
Rhpn1	A	G	15: 75,711,872	Q402R	possibly damaging	Het
Sec23b	T	A	2: 144,568,612		probably benign	Het
Sel1l2	A	T	2: 140,240,912	L602*	probably null	Het
Sema5b	G	A	16: 35,646,355	G209D	probably damaging	Het
Svep1	T	C	4: 58,073,333	Y1992C	possibly damaging	Het
Syncrip	T	A	9: 88,456,259		probably benign	Het
Synj1	G	T	16: 90,967,354	A65E	probably damaging	Het
Taar2	G	A	10: 23,941,495	R311H	probably benign	Het
Tecrl	T	C	5: 83,354,763		probably benign	Het
Tenm4	G	T	7: 96,777,851	G698C	probably damaging	Het
Tmem209	G	A	6: 30,491,182	L259F	probably damaging	Het
Tmem247	G	A	17: 86,918,503	E124K	possibly damaging	Het
Tnks2	C	A	19: 36,852,821	A218E	probably damaging	Het
Tppp	T	A	13: 74,021,311	F57I	probably damaging	Het
Trim36	A	G	18: 46,172,525	W452R	probably damaging	Het
Vars2	A	T	17: 35,664,584	V262E	probably damaging	Het
Vmn2r92	C	T	17: 18,167,957	A408V	probably damaging	Het
Zfp516	G	T	18: 82,955,772	A32S	probably benign	Het
Zfy2	G	T	Y: 2,107,348	L429I	possibly damaging	Het

Other mutations in Dicer1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00943:Dicer1	APN	12	104696772	missense	possibly damaging	0.93
IGL01061:Dicer1	APN	12	104706327	missense	probably null	0.75
IGL01527:Dicer1	APN	12	104691610	nonsense	probably null
IGL01597:Dicer1	APN	12	104705210	nonsense	probably null
IGL01636:Dicer1	APN	12	104722241	missense	probably damaging	1.00
IGL01717:Dicer1	APN	12	104702787	nonsense	probably null
IGL01765:Dicer1	APN	12	104706740	missense	probably damaging	1.00
IGL01871:Dicer1	APN	12	104704180	missense	probably damaging	1.00
IGL02316:Dicer1	APN	12	104702553	missense	probably damaging	1.00
IGL02317:Dicer1	APN	12	104697020	missense	probably damaging	1.00
IGL02539:Dicer1	APN	12	104697035	missense	probably damaging	0.97
IGL02544:Dicer1	APN	12	104714832	missense	probably damaging	1.00
IGL02664:Dicer1	APN	12	104705129	missense	probably damaging	1.00
IGL02667:Dicer1	APN	12	104714906	missense	probably damaging	1.00
IGL03353:Dicer1	APN	12	104713107	missense	probably damaging	1.00
IGL03377:Dicer1	APN	12	104712197	missense	probably damaging	0.98
everest	UTSW	12	104705128	missense	probably damaging	1.00
PIT4480001:Dicer1	UTSW	12	104696544	missense	probably benign
R0032:Dicer1	UTSW	12	104704798	nonsense	probably null
R0032:Dicer1	UTSW	12	104704798	nonsense	probably null
R0219:Dicer1	UTSW	12	104692125	critical splice donor site	probably null
R0242:Dicer1	UTSW	12	104702451	missense	probably benign	0.02
R0242:Dicer1	UTSW	12	104702451	missense	probably benign	0.02
R0385:Dicer1	UTSW	12	104704174	missense	probably damaging	1.00
R0402:Dicer1	UTSW	12	104731064	missense	probably benign	0.04
R0453:Dicer1	UTSW	12	104702630	missense	probably benign
R0502:Dicer1	UTSW	12	104705060	missense	probably damaging	1.00
R0507:Dicer1	UTSW	12	104691658	missense	probably damaging	1.00
R0511:Dicer1	UTSW	12	104702841	missense	possibly damaging	0.95
R0523:Dicer1	UTSW	12	104702491	missense	probably damaging	1.00
R0559:Dicer1	UTSW	12	104706301	missense	probably damaging	1.00
R0600:Dicer1	UTSW	12	104706864	missense	probably damaging	1.00
R0707:Dicer1	UTSW	12	104706885	missense	probably damaging	1.00
R1225:Dicer1	UTSW	12	104691607	missense	probably damaging	0.98
R1351:Dicer1	UTSW	12	104729142	missense	probably damaging	0.99
R1449:Dicer1	UTSW	12	104729243	missense	possibly damaging	0.85
R1575:Dicer1	UTSW	12	104721969	critical splice donor site	probably null
R1642:Dicer1	UTSW	12	104713156	missense	probably damaging	1.00
R1651:Dicer1	UTSW	12	104708805	missense	probably damaging	1.00
R1658:Dicer1	UTSW	12	104700414	missense	probably benign
R1815:Dicer1	UTSW	12	104722151	missense	probably damaging	1.00
R1816:Dicer1	UTSW	12	104722151	missense	probably damaging	1.00
R1927:Dicer1	UTSW	12	104702884	missense	possibly damaging	0.91
R2113:Dicer1	UTSW	12	104713214	missense	probably damaging	1.00
R2129:Dicer1	UTSW	12	104722031	missense	probably damaging	1.00
R2157:Dicer1	UTSW	12	104702949	missense	probably benign	0.17
R2202:Dicer1	UTSW	12	104731038	missense	probably damaging	0.98
R2203:Dicer1	UTSW	12	104731038	missense	probably damaging	0.98
R2243:Dicer1	UTSW	12	104730188	missense	probably damaging	0.99
R4237:Dicer1	UTSW	12	104729228	missense	possibly damaging	0.48
R4419:Dicer1	UTSW	12	104705114	missense	probably damaging	1.00
R4482:Dicer1	UTSW	12	104706277	missense	probably damaging	1.00
R4564:Dicer1	UTSW	12	104704751	nonsense	probably null
R4776:Dicer1	UTSW	12	104692446	missense	probably damaging	0.99
R4834:Dicer1	UTSW	12	104696591	missense	probably benign	0.44
R4904:Dicer1	UTSW	12	104713066	missense	probably benign
R5202:Dicer1	UTSW	12	104694731	nonsense	probably null
R5272:Dicer1	UTSW	12	104704240	missense	probably damaging	1.00
R5363:Dicer1	UTSW	12	104703151	missense	probably damaging	1.00
R5717:Dicer1	UTSW	12	104705128	missense	probably damaging	1.00
R6381:Dicer1	UTSW	12	104696462	missense	probably benign	0.00
R6479:Dicer1	UTSW	12	104696723	missense	probably damaging	0.97
R6956:Dicer1	UTSW	12	104731023	missense	probably damaging	1.00
R7234:Dicer1	UTSW	12	104708849	missense	probably damaging	1.00
R7401:Dicer1	UTSW	12	104712278	missense	probably benign
R7407:Dicer1	UTSW	12	104722351	nonsense	probably null
R7471:Dicer1	UTSW	12	104694710	missense	probably damaging	1.00
R7699:Dicer1	UTSW	12	104705170	missense	probably damaging	1.00
R7768:Dicer1	UTSW	12	104706697	missense	probably damaging	0.99
R7831:Dicer1	UTSW	12	104708800	missense	probably damaging	1.00
R7998:Dicer1	UTSW	12	104704069	missense	probably damaging	1.00
R8010:Dicer1	UTSW	12	104692132	missense	probably damaging	0.99
R8061:Dicer1	UTSW	12	104702818	nonsense	probably null
R8213:Dicer1	UTSW	12	104702693	missense	probably benign	0.00
R8261:Dicer1	UTSW	12	104691606	missense	probably damaging	1.00
R8419:Dicer1	UTSW	12	104702677	missense	probably benign	0.00
R8708:Dicer1	UTSW	12	104728445	missense	possibly damaging	0.65
R8851:Dicer1	UTSW	12	104724041	missense	possibly damaging	0.76
R9220:Dicer1	UTSW	12	104713156	missense	probably damaging	1.00
R9371:Dicer1	UTSW	12	104704732	missense	probably damaging	1.00
R9387:Dicer1	UTSW	12	104729240	missense	possibly damaging	0.48
X0018:Dicer1	UTSW	12	104696934	missense	probably benign	0.00
Z1176:Dicer1	UTSW	12	104731020	missense	probably null	0.97

Predicted Primers

PCR Primer
(F):5'- ACTTGGCCTGTTTTCAGGCACAC -3'
(R):5'- AAGCCCAGCAATGAATGTCCTCTAC -3'

Sequencing Primer
(F):5'- TTTCAGGCACACTGAAGAAGC -3'
(R):5'- TACCTTGATGGGAACGCTAAC -3'

Posted On

2013-05-23