Incidental Mutation 'R5063:Dzip1l'
ID386756
Institutional Source Beutler Lab
Gene Symbol Dzip1l
Ensembl Gene ENSMUSG00000037784
Gene NameDAZ interacting protein 1-like
Synonyms
MMRRC Submission 042653-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.268) question?
Stock #R5063 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location99629496-99669256 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 99667652 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 725 (E725G)
Ref Sequence ENSEMBL: ENSMUSP00000108506 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078367] [ENSMUST00000112884] [ENSMUST00000112885] [ENSMUST00000112886]
Predicted Effect probably damaging
Transcript: ENSMUST00000078367
AA Change: E725G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000077475
Gene: ENSMUSG00000037784
AA Change: E725G

DomainStartEndE-ValueType
Pfam:Dzip-like_N 24 144 5e-48 PFAM
low complexity region 153 159 N/A INTRINSIC
ZnF_C2H2 166 189 3.34e-2 SMART
low complexity region 221 238 N/A INTRINSIC
SCOP:d1eq1a_ 242 411 2e-3 SMART
low complexity region 422 441 N/A INTRINSIC
low complexity region 597 622 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112884
AA Change: E724G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000108505
Gene: ENSMUSG00000037784
AA Change: E724G

DomainStartEndE-ValueType
Pfam:Dzip-like_N 24 144 9.8e-48 PFAM
low complexity region 153 159 N/A INTRINSIC
ZnF_C2H2 166 189 3.34e-2 SMART
low complexity region 221 238 N/A INTRINSIC
SCOP:d1eq1a_ 242 411 2e-3 SMART
low complexity region 422 441 N/A INTRINSIC
low complexity region 597 621 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112885
AA Change: E725G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108506
Gene: ENSMUSG00000037784
AA Change: E725G

DomainStartEndE-ValueType
Pfam:Dzip-like_N 24 144 9.8e-48 PFAM
low complexity region 153 159 N/A INTRINSIC
ZnF_C2H2 166 189 3.34e-2 SMART
low complexity region 221 238 N/A INTRINSIC
SCOP:d1eq1a_ 242 411 2e-3 SMART
low complexity region 422 441 N/A INTRINSIC
low complexity region 597 622 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112886
AA Change: E724G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000108507
Gene: ENSMUSG00000037784
AA Change: E724G

DomainStartEndE-ValueType
Pfam:Dzip-like_N 24 144 9.8e-48 PFAM
low complexity region 153 159 N/A INTRINSIC
ZnF_C2H2 166 189 3.34e-2 SMART
low complexity region 221 238 N/A INTRINSIC
SCOP:d1eq1a_ 242 411 2e-3 SMART
low complexity region 422 441 N/A INTRINSIC
low complexity region 597 621 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130011E15Rik A G 19: 45,885,955 I593T possibly damaging Het
Aatk T C 11: 120,010,489 H970R probably benign Het
Anapc1 T C 2: 128,629,549 M1496V possibly damaging Het
Arhgef4 A T 1: 34,724,215 T851S probably benign Het
Cacna1d A G 14: 30,051,383 S1782P probably benign Het
Capn13 T A 17: 73,322,079 R578* probably null Het
Casp8 A T 1: 58,844,374 H280L probably damaging Het
Cd274 G T 19: 29,384,143 D284Y probably damaging Het
Cenpe T A 3: 135,270,954 C2441S probably damaging Het
Chn2 A T 6: 54,290,287 K118* probably null Het
Chst12 G T 5: 140,524,412 E265* probably null Het
Cp C A 3: 19,989,215 Q22K probably benign Het
Diaph3 A T 14: 86,984,870 W404R probably damaging Het
Dnajb13 T G 7: 100,510,823 E69A probably damaging Het
Dzip3 T A 16: 48,953,754 K373* probably null Het
Fmn1 C T 2: 113,364,921 T322I unknown Het
Gbp9 T C 5: 105,085,162 Y208C probably benign Het
Gtf2i T A 5: 134,260,571 K418N probably damaging Het
Herc3 C T 6: 58,855,760 Q137* probably null Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Iqcm A T 8: 75,746,286 D251V probably damaging Het
Itpr3 A T 17: 27,089,911 I363F possibly damaging Het
Khnyn A T 14: 55,887,203 K305* probably null Het
Klf17 A G 4: 117,760,659 V167A possibly damaging Het
Letm2 T C 8: 25,581,779 D369G probably benign Het
Lrrc31 A G 3: 30,689,936 V141A possibly damaging Het
Msh5 A T 17: 35,042,188 probably null Het
Neb G A 2: 52,223,212 probably benign Het
Olfr16 T A 1: 172,957,442 S216T possibly damaging Het
Olfr720 A T 14: 14,175,593 M163K probably damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Padi6 T C 4: 140,741,880 I50V probably benign Het
Pcdhb22 G T 18: 37,519,126 G216C probably damaging Het
Ppy A G 11: 102,100,699 Y5H probably benign Het
Psmc1 T C 12: 100,115,475 L112S probably damaging Het
Ptov1 A G 7: 44,865,602 I195T possibly damaging Het
Rassf10 C A 7: 112,954,424 D77E probably benign Het
Slc25a45 T C 19: 5,884,462 S153P possibly damaging Het
Slco1a5 G A 6: 142,259,065 R126C probably damaging Het
Srebf2 T C 15: 82,177,451 V366A probably benign Het
St6galnac5 T C 3: 152,981,135 S61G probably benign Het
Sult6b1 A T 17: 78,905,576 V82D probably benign Het
Tep1 A T 14: 50,850,627 C818S possibly damaging Het
Tex15 T G 8: 33,582,610 F2728L possibly damaging Het
Tm9sf2 T A 14: 122,145,146 F190Y probably damaging Het
Tmem175 T C 5: 108,646,432 L476P probably damaging Het
Tmprss11c T C 5: 86,237,830 K248R probably benign Het
Tnk2 T A 16: 32,670,850 F316I probably damaging Het
Vmn2r75 T A 7: 86,164,164 M477L probably benign Het
Vmn2r83 A C 10: 79,479,087 I390L probably benign Het
Vmn2r88 A G 14: 51,411,146 Y49C probably damaging Het
Zdhhc4 T A 5: 143,316,622 I318F probably damaging Het
Zmat4 A T 8: 23,748,441 D27V probably damaging Het
Other mutations in Dzip1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Dzip1l APN 9 99637777 missense probably damaging 0.99
IGL01992:Dzip1l APN 9 99663686 missense probably damaging 1.00
R0276:Dzip1l UTSW 9 99660998 missense probably benign 0.38
R0506:Dzip1l UTSW 9 99663081 missense possibly damaging 0.76
R1469:Dzip1l UTSW 9 99659776 critical splice donor site probably null
R1469:Dzip1l UTSW 9 99659776 critical splice donor site probably null
R2904:Dzip1l UTSW 9 99663669 missense probably damaging 0.99
R2905:Dzip1l UTSW 9 99663669 missense probably damaging 0.99
R2911:Dzip1l UTSW 9 99655602 missense probably benign 0.00
R3106:Dzip1l UTSW 9 99642572 nonsense probably null
R3106:Dzip1l UTSW 9 99647121 missense probably benign 0.00
R4394:Dzip1l UTSW 9 99639854 missense probably damaging 1.00
R4570:Dzip1l UTSW 9 99647168 nonsense probably null
R4579:Dzip1l UTSW 9 99647214 missense probably damaging 1.00
R4695:Dzip1l UTSW 9 99647205 missense probably benign 0.11
R4696:Dzip1l UTSW 9 99663611 missense possibly damaging 0.94
R4748:Dzip1l UTSW 9 99642651 missense probably damaging 0.96
R5747:Dzip1l UTSW 9 99639809 splice site probably null
R6089:Dzip1l UTSW 9 99642684 missense possibly damaging 0.63
R7030:Dzip1l UTSW 9 99665835 missense probably benign 0.00
R7454:Dzip1l UTSW 9 99659674 missense possibly damaging 0.59
R7485:Dzip1l UTSW 9 99661012 missense probably benign 0.02
R7706:Dzip1l UTSW 9 99637536 missense probably damaging 1.00
R7734:Dzip1l UTSW 9 99667682 missense probably damaging 1.00
R7790:Dzip1l UTSW 9 99660962 missense possibly damaging 0.58
R8463:Dzip1l UTSW 9 99637822 missense possibly damaging 0.92
Z1176:Dzip1l UTSW 9 99641761 missense possibly damaging 0.59
Z1177:Dzip1l UTSW 9 99665854 missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- GAGTATCCCATCACAGTGGC -3'
(R):5'- TTCCATTTGGGTGAGACCAG -3'

Sequencing Primer
(F):5'- ATCACAGTGGCCCTGAGTCTC -3'
(R):5'- GGTGAGACCAGCCAAGAAAC -3'
Posted On2016-06-06