Mutagenetix > Incidental Mutation

Incidental Mutation 'R5074:Pik3c2g'

386823

Institutional Source

Beutler Lab

Gene Symbol

Pik3c2g

Ensembl Gene

ENSMUSG00000030228

Gene Name

phosphatidylinositol-4-phosphate 3-kinase catalytic subunit type 2 gamma

Synonyms

MMRRC Submission

042663-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.087) question?

Stock #

R5074 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

139587221-139969284 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 139720147 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Serine at position 65 (C65S)

Ref Sequence

ENSEMBL: ENSMUSP00000107499 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000111868]

AlphaFold

no structure available at present

Predicted Effect

probably null
Transcript: ENSMUST00000111868
AA Change: C65S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000107499
Gene: ENSMUSG00000030228
AA Change: C65S

Domain	Start	End	E-Value	Type
SCOP:d1e8xa2	1	83	4e-16	SMART
PI3Ka	103	288	7.6e-29	SMART
PI3Kc	375	637	2.11e-109	SMART
PX	661	765	1.24e-21	SMART
C2	800	897	1.34e-7	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000187069

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.0%
20x: 94.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the phosphoinositide 3-kinase (PI3K) family. PI3-kinases play roles in signaling pathways involved in cell proliferation, oncogenic transformation, cell survival, cell migration, and intracellular protein trafficking. This protein contains a lipid kinase catalytic domain as well as a C-terminal C2 domain, a characteristic of class II PI3-kinases. C2 domains act as calcium-dependent phospholipid binding motifs that mediate translocation of proteins to membranes, and may also mediate protein-protein interactions. This gene may play a role in several diseases, including type II diabetes. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
PHENOTYPE: Mice homozygous for a knock-out allelel exhibit reduced liver glucogen accumulation, hyperlipidemia, adiposity and insulin resistance with age or after consumption of a high-fat diet. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 115 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700006A11Rik	A	T	3: 124,416,833	H143Q	probably benign	Het
Abca3	C	T	17: 24,374,300	R224C	probably damaging	Het
Adcy8	A	T	15: 64,787,358	W528R	probably damaging	Het
Agbl1	A	G	7: 76,421,917	E329G	probably damaging	Het
Agbl5	G	A	5: 30,903,059	R141Q	probably damaging	Het
Ampd2	A	T	3: 108,079,233	M245K	probably damaging	Het
Apob	G	A	12: 8,005,219		probably null	Het
Apool	C	T	X: 112,349,843	Q60*	probably null	Het
Aqp1	A	T	6: 55,345,535	I172F	probably damaging	Het
Atp7a	A	G	X: 106,109,768	D1092G	probably benign	Het
Ccdc114	T	A	7: 45,929,090	M29K	probably benign	Het
Ccdc83	A	T	7: 90,250,529	F45Y	probably damaging	Het
Cct8l1	G	A	5: 25,516,883	V199I	probably benign	Het
Cdc23	C	A	18: 34,651,689	V7L	unknown	Het
Cdc25a	T	A	9: 109,884,140	C227S	possibly damaging	Het
Ces1a	A	G	8: 93,032,675	S278P	possibly damaging	Het
Cfap65	A	T	1: 74,922,978	S695T	probably benign	Het
Col13a1	A	G	10: 61,874,018		silent	Het
Ctps	A	T	4: 120,553,973	L282Q	probably damaging	Het
Cyp2a22	A	T	7: 26,932,481	F450Y	probably benign	Het
Cyp2d10	C	T	15: 82,403,753	R383H	probably benign	Het
Dennd3	G	A	15: 73,547,295	R645H	probably damaging	Het
Dnaaf5	G	T	5: 139,174,207	R620L	probably damaging	Het
Dnah11	A	T	12: 118,082,453	L1750*	probably null	Het
Dnah9	A	G	11: 65,850,040	F4107L	probably damaging	Het
Dnaja3	A	T	16: 4,696,425	T274S	probably damaging	Het
Dot1l	A	G	10: 80,784,646	D514G	possibly damaging	Het
Dst	A	C	1: 34,295,263	K4857N	probably damaging	Het
Dysf	A	T	6: 84,137,272	K1226M	probably damaging	Het
Enpep	T	A	3: 129,303,755	Q409L	probably damaging	Het
Fign	A	T	2: 63,979,693	L411*	probably null	Het
Flt1	C	A	5: 147,683,939	A132S	probably benign	Het
Fryl	G	A	5: 73,074,767	P1550L	probably damaging	Het
Gas2l3	CACTCGTCATACT	CACT	10: 89,430,958		probably benign	Het
H2afb3	T	C	X: 120,312,846	T84A	probably damaging	Het
Hal	A	T	10: 93,514,042	I555F	probably damaging	Het
Hibadh	C	T	6: 52,620,094	V122M	possibly damaging	Het
Hsd3b3	T	C	3: 98,742,024	T328A	possibly damaging	Het
Ifi44	T	C	3: 151,749,632		probably benign	Het
Ifi47	A	G	11: 49,095,534	T43A	probably benign	Het
Inf2	A	T	12: 112,612,039		probably null	Het
Itga10	C	T	3: 96,652,211	Q475*	probably null	Het
Itga6	T	A	2: 71,826,435	D344E	probably benign	Het
Kcnmb4	T	C	10: 116,473,197	T109A	probably benign	Het
Kif19a	G	A	11: 114,767,227	M37I	probably benign	Het
Kiss1r	C	A	10: 79,918,762	S30*	probably null	Het
Lrrc66	G	A	5: 73,608,011	P563L	probably damaging	Het
Mamdc2	T	C	19: 23,378,796	D96G	probably benign	Het
Map3k12	A	T	15: 102,501,832		probably null	Het
Mc3r	A	T	2: 172,249,613	I252F	possibly damaging	Het
Metrn	C	T	17: 25,796,639	G34D	probably damaging	Het
Mipep	A	G	14: 60,809,013	E328G	probably benign	Het
Mkl1	A	G	15: 81,022,426	V91A	probably damaging	Het
Muc5b	A	T	7: 141,859,262	T1982S	unknown	Het
Myh8	A	T	11: 67,305,916	T1792S	possibly damaging	Het
Myo1a	T	C	10: 127,707,419		probably null	Het
Myo5a	T	A	9: 75,174,156	S1008T	probably benign	Het
Ncald	A	T	15: 37,397,234	H67Q	probably damaging	Het
Nudt5	T	A	2: 5,864,387	H141Q	probably benign	Het
Numbl	G	A	7: 27,280,990	D466N	probably damaging	Het
Nup210	T	A	6: 91,055,327	I20F	probably benign	Het
Olfr1100	A	T	2: 86,978,322	V158D	possibly damaging	Het
Olfr1335	A	C	4: 118,808,860	W319G	possibly damaging	Het
Olfr310	A	G	7: 86,269,591	I66T	probably damaging	Het
Olfr606	A	T	7: 103,451,410	E24D	probably benign	Het
Olfr668	A	C	7: 104,925,493	N90K	probably benign	Het
Olfr675	A	T	7: 105,024,053	M309K	probably benign	Het
Olfr763	T	C	10: 129,011,344	Y20H	possibly damaging	Het
Olfr871	A	T	9: 20,212,582	I78F	possibly damaging	Het
Papolg	G	A	11: 23,867,331	T153I	possibly damaging	Het
Pappa	A	G	4: 65,205,128	H900R	probably benign	Het
Pcdh17	T	C	14: 84,533,342	S1087P	probably benign	Het
Phf11a	T	G	14: 59,284,400	L107F	possibly damaging	Het
Phlpp2	A	T	8: 109,925,829	I602F	probably damaging	Het
Pilra	A	G	5: 137,835,412	F131L	probably damaging	Het
Pomt2	A	C	12: 87,133,460	C256G	probably damaging	Het
Ppl	A	T	16: 5,088,878	S1184R	probably benign	Het
Prkaa1	G	T	15: 5,176,911	R416L	possibly damaging	Het
Prkdc	C	A	16: 15,772,048	R2592S	probably damaging	Het
Prmt2	C	T	10: 76,222,556	V140I	probably damaging	Het
Prodh	A	T	16: 18,077,789		probably null	Het
Psg29	T	A	7: 17,211,838	D444E	probably damaging	Het
Ptgs1	A	T	2: 36,251,260	N573I	probably damaging	Het
Rbm38	C	T	2: 173,022,082	P15S	probably benign	Het
Riox2	T	C	16: 59,491,873	S458P	possibly damaging	Het
Rnase4	T	C	14: 51,105,245	V142A	possibly damaging	Het
Rnf138	A	G	18: 21,026,147	N244S	probably benign	Het
Rnf40	T	C	7: 127,597,286	L802P	probably damaging	Het
Sfxn4	C	T	19: 60,851,012	V203M	probably damaging	Het
Skor2	G	T	18: 76,858,954	E124*	probably null	Het
Slc4a2	G	A	5: 24,438,762	S855N	probably benign	Het
Slc8a2	T	C	7: 16,150,583	L626P	possibly damaging	Het
Slco4c1	G	A	1: 96,841,228	P303L	probably damaging	Het
Slirp	A	G	12: 87,444,014	T29A	probably damaging	Het
Snrpd3	G	T	10: 75,519,393	C20F	possibly damaging	Het
Spag17	T	A	3: 100,080,118	Y1575N	possibly damaging	Het
St8sia4	G	A	1: 95,667,185	A26V	probably benign	Het
Stab2	A	T	10: 86,863,558	I481N	probably benign	Het
Tenm2	T	A	11: 36,068,381	T1114S	probably damaging	Het
Tgm1	A	G	14: 55,709,935	V323A	probably damaging	Het
Tmco4	A	G	4: 139,058,122	H501R	probably damaging	Het
Tob1	A	T	11: 94,213,741	R34S	possibly damaging	Het
Trhr2	C	T	8: 122,357,371	V297I	probably benign	Het
Trim30d	A	C	7: 104,487,958	V13G	probably damaging	Het
Trpm3	T	C	19: 22,885,349	V485A	possibly damaging	Het
Trrap	T	C	5: 144,851,179	I3518T	probably damaging	Het
Ttc27	T	C	17: 74,747,755	L352P	probably damaging	Het
Ush1g	A	G	11: 115,318,297	L357P	possibly damaging	Het
Usp24	A	G	4: 106,420,447	H2258R	probably benign	Het
Vcam1	A	G	3: 116,124,388	V308A	probably damaging	Het
Vdr	A	G	15: 97,857,578	S355P	probably benign	Het
Vldlr	T	C	19: 27,238,277	S184P	probably damaging	Het
Xpo4	C	A	14: 57,584,641	A1073S	probably benign	Het
Zfand2b	A	G	1: 75,170,990	D224G	probably benign	Het
Zfp263	A	G	16: 3,746,840	R240G	possibly damaging	Het

Other mutations in Pik3c2g

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00159:Pik3c2g	APN	6	139896125	missense	probably damaging	1.00
IGL01355:Pik3c2g	APN	6	139852857	missense	probably damaging	0.98
IGL01579:Pik3c2g	APN	6	139754741	nonsense	probably null
IGL01580:Pik3c2g	APN	6	139622516	missense	probably damaging	0.99
IGL01587:Pik3c2g	APN	6	139754741	nonsense	probably null
IGL01813:Pik3c2g	APN	6	139622409	missense	possibly damaging	0.55
IGL02218:Pik3c2g	APN	6	139860355	missense	probably damaging	1.00
IGL02479:Pik3c2g	APN	6	139918004	missense	probably benign	0.40
IGL02480:Pik3c2g	APN	6	139852800	missense	probably damaging	1.00
IGL02721:Pik3c2g	APN	6	139736973	missense	probably benign	0.15
IGL02967:Pik3c2g	APN	6	139967828	missense	probably damaging	0.98
IGL03221:Pik3c2g	APN	6	139772407	critical splice acceptor site	probably null
FR4304:Pik3c2g	UTSW	6	139635656	frame shift	probably null
FR4340:Pik3c2g	UTSW	6	139635656	frame shift	probably null
FR4976:Pik3c2g	UTSW	6	139635654	frame shift	probably null
IGL02837:Pik3c2g	UTSW	6	139626564	nonsense	probably null
PIT4531001:Pik3c2g	UTSW	6	139859370	missense
R0002:Pik3c2g	UTSW	6	139768745	missense	probably benign	0.08
R0081:Pik3c2g	UTSW	6	139957793	missense	probably benign	0.05
R0098:Pik3c2g	UTSW	6	139662443	missense	unknown
R0719:Pik3c2g	UTSW	6	139629725	missense	probably damaging	1.00
R0740:Pik3c2g	UTSW	6	139633793	critical splice donor site	probably null
R0837:Pik3c2g	UTSW	6	139957699	splice site	probably benign
R0840:Pik3c2g	UTSW	6	139896072	missense	probably damaging	1.00
R1306:Pik3c2g	UTSW	6	139772428	missense	probably benign
R1501:Pik3c2g	UTSW	6	139844070	critical splice donor site	probably null
R1591:Pik3c2g	UTSW	6	139748178	missense	probably benign	0.00
R1666:Pik3c2g	UTSW	6	139635636	intron	probably benign
R1907:Pik3c2g	UTSW	6	139844042	missense	probably damaging	1.00
R1970:Pik3c2g	UTSW	6	139900386	critical splice donor site	probably null
R1982:Pik3c2g	UTSW	6	139622548	missense	probably damaging	0.97
R2171:Pik3c2g	UTSW	6	139855286	nonsense	probably null
R2188:Pik3c2g	UTSW	6	139852874	missense	probably damaging	1.00
R3777:Pik3c2g	UTSW	6	139622387	missense	probably damaging	1.00
R3778:Pik3c2g	UTSW	6	139622387	missense	probably damaging	1.00
R3965:Pik3c2g	UTSW	6	139855292	missense	possibly damaging	0.90
R4076:Pik3c2g	UTSW	6	139852863	missense	probably damaging	1.00
R4078:Pik3c2g	UTSW	6	139635610	intron	probably benign
R4108:Pik3c2g	UTSW	6	139730370	missense	probably benign	0.00
R4461:Pik3c2g	UTSW	6	139841681	intron	probably benign
R4474:Pik3c2g	UTSW	6	139633751	missense	probably damaging	0.99
R4509:Pik3c2g	UTSW	6	139720006	missense	probably benign	0.25
R4646:Pik3c2g	UTSW	6	139720018	missense	probably benign	0.05
R4732:Pik3c2g	UTSW	6	139935985	missense	probably benign	0.28
R4733:Pik3c2g	UTSW	6	139935985	missense	probably benign	0.28
R4854:Pik3c2g	UTSW	6	139768779	missense	probably damaging	1.00
R4928:Pik3c2g	UTSW	6	139967802	missense	possibly damaging	0.88
R4959:Pik3c2g	UTSW	6	139843931	missense	possibly damaging	0.65
R4973:Pik3c2g	UTSW	6	139843931	missense	possibly damaging	0.65
R5032:Pik3c2g	UTSW	6	139896202	missense	probably benign	0.00
R5071:Pik3c2g	UTSW	6	139720147	missense	probably null	0.00
R5072:Pik3c2g	UTSW	6	139720147	missense	probably null	0.00
R5073:Pik3c2g	UTSW	6	139720147	missense	probably null	0.00
R5107:Pik3c2g	UTSW	6	139635625	intron	probably benign
R5186:Pik3c2g	UTSW	6	139622018	missense	probably damaging	1.00
R5253:Pik3c2g	UTSW	6	139896257	critical splice donor site	probably null
R5359:Pik3c2g	UTSW	6	139622123	missense	probably damaging	1.00
R5394:Pik3c2g	UTSW	6	139720082	missense	probably benign
R5417:Pik3c2g	UTSW	6	139736943	missense	probably benign
R5435:Pik3c2g	UTSW	6	139715855	splice site	probably null
R5580:Pik3c2g	UTSW	6	139626533	missense	probably damaging	0.99
R5664:Pik3c2g	UTSW	6	139737007	missense	probably damaging	0.98
R5908:Pik3c2g	UTSW	6	139768710	missense
R5914:Pik3c2g	UTSW	6	139622479	missense	probably benign	0.00
R6046:Pik3c2g	UTSW	6	139622139	missense	probably damaging	0.96
R6046:Pik3c2g	UTSW	6	139896792	missense	probably damaging	1.00
R6298:Pik3c2g	UTSW	6	139626563	missense	probably damaging	1.00
R6382:Pik3c2g	UTSW	6	139719998	missense	possibly damaging	0.88
R6480:Pik3c2g	UTSW	6	139730469	missense	probably benign	0.27
R6917:Pik3c2g	UTSW	6	139896173	missense	probably benign	0.00
R6929:Pik3c2g	UTSW	6	139957776	missense	possibly damaging	0.67
R7022:Pik3c2g	UTSW	6	139622063	missense	possibly damaging	0.82
R7144:Pik3c2g	UTSW	6	139629870	missense	probably damaging	1.00
R7213:Pik3c2g	UTSW	6	139860264	missense
R7215:Pik3c2g	UTSW	6	139754863	missense
R7332:Pik3c2g	UTSW	6	139896255	missense
R7357:Pik3c2g	UTSW	6	139633793	critical splice donor site	probably null
R7359:Pik3c2g	UTSW	6	139967894	missense	unknown
R7385:Pik3c2g	UTSW	6	139855353	missense
R7455:Pik3c2g	UTSW	6	139967917	missense	unknown
R7651:Pik3c2g	UTSW	6	139622072	missense	possibly damaging	0.85
R7888:Pik3c2g	UTSW	6	139896744	missense
R7923:Pik3c2g	UTSW	6	139633793	critical splice donor site	probably null
R7964:Pik3c2g	UTSW	6	139882060	missense
R8005:Pik3c2g	UTSW	6	139622069	missense	probably benign	0.01
R8371:Pik3c2g	UTSW	6	139936056	missense	unknown
R8724:Pik3c2g	UTSW	6	139967893	missense	unknown
R8733:Pik3c2g	UTSW	6	139768700	nonsense	probably null
R8809:Pik3c2g	UTSW	6	139768710	missense
R8888:Pik3c2g	UTSW	6	139730366	nonsense	probably null
R8931:Pik3c2g	UTSW	6	139875367	missense	probably benign	0.02
R9188:Pik3c2g	UTSW	6	139622403	missense	possibly damaging	0.94
R9336:Pik3c2g	UTSW	6	139875435	missense
R9383:Pik3c2g	UTSW	6	139882016	nonsense	probably null
R9524:Pik3c2g	UTSW	6	139629770	missense	probably damaging	0.99
R9531:Pik3c2g	UTSW	6	139896200	missense
R9630:Pik3c2g	UTSW	6	139622239	missense	possibly damaging	0.66
R9697:Pik3c2g	UTSW	6	139967791	missense	unknown
R9708:Pik3c2g	UTSW	6	139629867	missense	probably benign
R9717:Pik3c2g	UTSW	6	139896184	missense
RF015:Pik3c2g	UTSW	6	139754771	missense
RF032:Pik3c2g	UTSW	6	139635658	frame shift	probably null
X0024:Pik3c2g	UTSW	6	139860258	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGCTTATGAGAAATACGACCCTTC -3'
(R):5'- AATGAGCCACAGTCTGTAGTC -3'

Sequencing Primer
(F):5'- TATGAGAAATACGACCCTTCACAGAC -3'
(R):5'- TGGTGAAAGGAAAATTAATACTCACC -3'

Posted On

2016-06-06