Incidental Mutation 'R5074:Trhr2'
ID386843
Institutional Source Beutler Lab
Gene Symbol Trhr2
Ensembl Gene ENSMUSG00000039079
Gene Namethyrotropin releasing hormone receptor 2
SynonymsTRH-R2
MMRRC Submission 042663-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.137) question?
Stock #R5074 (G1)
Quality Score192
Status Not validated
Chromosome8
Chromosomal Location122356967-122360746 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 122357371 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 297 (V297I)
Ref Sequence ENSEMBL: ENSMUSP00000042575 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044123] [ENSMUST00000127664]
Predicted Effect probably benign
Transcript: ENSMUST00000044123
AA Change: V297I

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000042575
Gene: ENSMUSG00000039079
AA Change: V297I

DomainStartEndE-ValueType
Pfam:7tm_4 29 184 1e-12 PFAM
Pfam:7TM_GPCR_Srv 29 325 2e-7 PFAM
Pfam:7TM_GPCR_Srx 30 165 4.8e-7 PFAM
Pfam:7TM_GPCR_Srsx 33 323 5.6e-10 PFAM
Pfam:7tm_1 39 308 5.4e-54 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 115 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik A T 3: 124,416,833 H143Q probably benign Het
Abca3 C T 17: 24,374,300 R224C probably damaging Het
Adcy8 A T 15: 64,787,358 W528R probably damaging Het
Agbl1 A G 7: 76,421,917 E329G probably damaging Het
Agbl5 G A 5: 30,903,059 R141Q probably damaging Het
Ampd2 A T 3: 108,079,233 M245K probably damaging Het
Apob G A 12: 8,005,219 probably null Het
Apool C T X: 112,349,843 Q60* probably null Het
Aqp1 A T 6: 55,345,535 I172F probably damaging Het
Atp7a A G X: 106,109,768 D1092G probably benign Het
Ccdc114 T A 7: 45,929,090 M29K probably benign Het
Ccdc83 A T 7: 90,250,529 F45Y probably damaging Het
Cct8l1 G A 5: 25,516,883 V199I probably benign Het
Cdc23 C A 18: 34,651,689 V7L unknown Het
Cdc25a T A 9: 109,884,140 C227S possibly damaging Het
Ces1a A G 8: 93,032,675 S278P possibly damaging Het
Cfap65 A T 1: 74,922,978 S695T probably benign Het
Col13a1 A G 10: 61,874,018 silent Het
Ctps A T 4: 120,553,973 L282Q probably damaging Het
Cyp2a22 A T 7: 26,932,481 F450Y probably benign Het
Cyp2d10 C T 15: 82,403,753 R383H probably benign Het
Dennd3 G A 15: 73,547,295 R645H probably damaging Het
Dnaaf5 G T 5: 139,174,207 R620L probably damaging Het
Dnah11 A T 12: 118,082,453 L1750* probably null Het
Dnah9 A G 11: 65,850,040 F4107L probably damaging Het
Dnaja3 A T 16: 4,696,425 T274S probably damaging Het
Dot1l A G 10: 80,784,646 D514G possibly damaging Het
Dst A C 1: 34,295,263 K4857N probably damaging Het
Dysf A T 6: 84,137,272 K1226M probably damaging Het
Enpep T A 3: 129,303,755 Q409L probably damaging Het
Fign A T 2: 63,979,693 L411* probably null Het
Flt1 C A 5: 147,683,939 A132S probably benign Het
Fryl G A 5: 73,074,767 P1550L probably damaging Het
Gas2l3 CACTCGTCATACT CACT 10: 89,430,958 probably benign Het
H2afb3 T C X: 120,312,846 T84A probably damaging Het
Hal A T 10: 93,514,042 I555F probably damaging Het
Hibadh C T 6: 52,620,094 V122M possibly damaging Het
Hsd3b3 T C 3: 98,742,024 T328A possibly damaging Het
Ifi44 T C 3: 151,749,632 probably benign Het
Ifi47 A G 11: 49,095,534 T43A probably benign Het
Inf2 A T 12: 112,612,039 probably null Het
Itga10 C T 3: 96,652,211 Q475* probably null Het
Itga6 T A 2: 71,826,435 D344E probably benign Het
Kcnmb4 T C 10: 116,473,197 T109A probably benign Het
Kif19a G A 11: 114,767,227 M37I probably benign Het
Kiss1r C A 10: 79,918,762 S30* probably null Het
Lrrc66 G A 5: 73,608,011 P563L probably damaging Het
Mamdc2 T C 19: 23,378,796 D96G probably benign Het
Map3k12 A T 15: 102,501,832 probably null Het
Mc3r A T 2: 172,249,613 I252F possibly damaging Het
Metrn C T 17: 25,796,639 G34D probably damaging Het
Mipep A G 14: 60,809,013 E328G probably benign Het
Mkl1 A G 15: 81,022,426 V91A probably damaging Het
Muc5b A T 7: 141,859,262 T1982S unknown Het
Myh8 A T 11: 67,305,916 T1792S possibly damaging Het
Myo1a T C 10: 127,707,419 probably null Het
Myo5a T A 9: 75,174,156 S1008T probably benign Het
Ncald A T 15: 37,397,234 H67Q probably damaging Het
Nudt5 T A 2: 5,864,387 H141Q probably benign Het
Numbl G A 7: 27,280,990 D466N probably damaging Het
Nup210 T A 6: 91,055,327 I20F probably benign Het
Olfr1100 A T 2: 86,978,322 V158D possibly damaging Het
Olfr1335 A C 4: 118,808,860 W319G possibly damaging Het
Olfr310 A G 7: 86,269,591 I66T probably damaging Het
Olfr606 A T 7: 103,451,410 E24D probably benign Het
Olfr668 A C 7: 104,925,493 N90K probably benign Het
Olfr675 A T 7: 105,024,053 M309K probably benign Het
Olfr763 T C 10: 129,011,344 Y20H possibly damaging Het
Olfr871 A T 9: 20,212,582 I78F possibly damaging Het
Papolg G A 11: 23,867,331 T153I possibly damaging Het
Pappa A G 4: 65,205,128 H900R probably benign Het
Pcdh17 T C 14: 84,533,342 S1087P probably benign Het
Phf11a T G 14: 59,284,400 L107F possibly damaging Het
Phlpp2 A T 8: 109,925,829 I602F probably damaging Het
Pik3c2g T A 6: 139,720,147 C65S probably null Het
Pilra A G 5: 137,835,412 F131L probably damaging Het
Pomt2 A C 12: 87,133,460 C256G probably damaging Het
Ppl A T 16: 5,088,878 S1184R probably benign Het
Prkaa1 G T 15: 5,176,911 R416L possibly damaging Het
Prkdc C A 16: 15,772,048 R2592S probably damaging Het
Prmt2 C T 10: 76,222,556 V140I probably damaging Het
Prodh A T 16: 18,077,789 probably null Het
Psg29 T A 7: 17,211,838 D444E probably damaging Het
Ptgs1 A T 2: 36,251,260 N573I probably damaging Het
Rbm38 C T 2: 173,022,082 P15S probably benign Het
Riox2 T C 16: 59,491,873 S458P possibly damaging Het
Rnase4 T C 14: 51,105,245 V142A possibly damaging Het
Rnf138 A G 18: 21,026,147 N244S probably benign Het
Rnf40 T C 7: 127,597,286 L802P probably damaging Het
Sfxn4 C T 19: 60,851,012 V203M probably damaging Het
Skor2 G T 18: 76,858,954 E124* probably null Het
Slc4a2 G A 5: 24,438,762 S855N probably benign Het
Slc8a2 T C 7: 16,150,583 L626P possibly damaging Het
Slco4c1 G A 1: 96,841,228 P303L probably damaging Het
Slirp A G 12: 87,444,014 T29A probably damaging Het
Snrpd3 G T 10: 75,519,393 C20F possibly damaging Het
Spag17 T A 3: 100,080,118 Y1575N possibly damaging Het
St8sia4 G A 1: 95,667,185 A26V probably benign Het
Stab2 A T 10: 86,863,558 I481N probably benign Het
Tenm2 T A 11: 36,068,381 T1114S probably damaging Het
Tgm1 A G 14: 55,709,935 V323A probably damaging Het
Tmco4 A G 4: 139,058,122 H501R probably damaging Het
Tob1 A T 11: 94,213,741 R34S possibly damaging Het
Trim30d A C 7: 104,487,958 V13G probably damaging Het
Trpm3 T C 19: 22,885,349 V485A possibly damaging Het
Trrap T C 5: 144,851,179 I3518T probably damaging Het
Ttc27 T C 17: 74,747,755 L352P probably damaging Het
Ush1g A G 11: 115,318,297 L357P possibly damaging Het
Usp24 A G 4: 106,420,447 H2258R probably benign Het
Vcam1 A G 3: 116,124,388 V308A probably damaging Het
Vdr A G 15: 97,857,578 S355P probably benign Het
Vldlr T C 19: 27,238,277 S184P probably damaging Het
Xpo4 C A 14: 57,584,641 A1073S probably benign Het
Zfand2b A G 1: 75,170,990 D224G probably benign Het
Zfp263 A G 16: 3,746,840 R240G possibly damaging Het
Other mutations in Trhr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03070:Trhr2 APN 8 122358603 missense probably benign
IGL03387:Trhr2 APN 8 122358481 intron probably benign
IGL03408:Trhr2 APN 8 122358795 missense probably damaging 1.00
R0546:Trhr2 UTSW 8 122358489 critical splice donor site probably null
R1135:Trhr2 UTSW 8 122358633 missense probably damaging 1.00
R1377:Trhr2 UTSW 8 122360588 missense probably damaging 1.00
R1656:Trhr2 UTSW 8 122357446 missense probably damaging 1.00
R2055:Trhr2 UTSW 8 122358793 missense probably damaging 1.00
R4030:Trhr2 UTSW 8 122360699 start codon destroyed probably null 0.01
R4998:Trhr2 UTSW 8 122358772 missense probably benign 0.04
R6175:Trhr2 UTSW 8 122357379 missense probably damaging 0.99
R7048:Trhr2 UTSW 8 122358679 missense probably damaging 1.00
R7168:Trhr2 UTSW 8 122360537 missense probably damaging 1.00
R7185:Trhr2 UTSW 8 122360657 missense probably benign 0.26
R7284:Trhr2 UTSW 8 122360375 missense probably damaging 1.00
R7314:Trhr2 UTSW 8 122358750 missense possibly damaging 0.64
R7644:Trhr2 UTSW 8 122357322 missense possibly damaging 0.93
R7891:Trhr2 UTSW 8 122357344 missense probably damaging 0.99
R7974:Trhr2 UTSW 8 122357344 missense probably damaging 0.99
Z1176:Trhr2 UTSW 8 122358795 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTCAGTTCCTAGGGAGGTC -3'
(R):5'- TGGCACCTGACATATGCAGC -3'

Sequencing Primer
(F):5'- TCTCCTGGGCAGCACTGTAG -3'
(R):5'- ATATGCAGCAACCCTGTTGTCAG -3'
Posted On2016-06-06