Mutagenetix > Incidental Mutation

Incidental Mutation 'R5074:Tenm2'

386859

Institutional Source

Beutler Lab

Gene Symbol

Tenm2

Ensembl Gene

ENSMUSG00000049336

Gene Name

teneurin transmembrane protein 2

Synonyms

2610040L17Rik, 9330187F13Rik, D3Bwg1534e, Ten-m2, Odz2

MMRRC Submission

042663-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.514) question?

Stock #

R5074 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

36006656-37235964 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 36068381 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Serine at position 1114 (T1114S)

Ref Sequence

ENSEMBL: ENSMUSP00000052014 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000057207] [ENSMUST00000102801] [ENSMUST00000163524]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000057207
AA Change: T1114S

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000052014
Gene: ENSMUSG00000049336
AA Change: T1114S

Domain	Start	End	E-Value	Type
Pfam:Ten_N	10	374	4.9e-177	PFAM
transmembrane domain	375	397	N/A	INTRINSIC
EGF	575	603	5.62e0	SMART
EGF_like	606	634	4.93e1	SMART
EGF	639	668	1.76e1	SMART
EGF	671	700	1.43e-1	SMART
EGF	705	735	1.2e1	SMART
EGF	738	766	9.63e0	SMART
EGF	769	797	1.25e1	SMART
EGF	800	832	1.4e0	SMART
low complexity region	1459	1475	N/A	INTRINSIC
low complexity region	2219	2230	N/A	INTRINSIC
Pfam:Tox-GHH	2681	2758	1.4e-34	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000102801
AA Change: T1113S

PolyPhen 2 Score 0.366 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000099865
Gene: ENSMUSG00000049336
AA Change: T1113S

Domain	Start	End	E-Value	Type
Pfam:Ten_N	9	374	2e-186	PFAM
transmembrane domain	375	397	N/A	INTRINSIC
EGF	575	603	5.62e0	SMART
EGF_like	606	634	4.93e1	SMART
EGF	639	668	1.76e1	SMART
EGF	671	700	1.43e-1	SMART
EGF	705	735	1.2e1	SMART
EGF	737	765	9.63e0	SMART
EGF	768	796	1.25e1	SMART
EGF	799	831	1.4e0	SMART
low complexity region	1458	1474	N/A	INTRINSIC
low complexity region	2218	2229	N/A	INTRINSIC
Pfam:Tox-GHH	2679	2757	2e-34	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000163524
AA Change: T1113S

PolyPhen 2 Score 0.366 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000129951
Gene: ENSMUSG00000049336
AA Change: T1113S

Domain	Start	End	E-Value	Type
Pfam:Ten_N	9	374	2e-186	PFAM
transmembrane domain	375	397	N/A	INTRINSIC
EGF	575	603	5.62e0	SMART
EGF_like	606	634	4.93e1	SMART
EGF	639	668	1.76e1	SMART
EGF	671	700	1.43e-1	SMART
EGF	705	735	1.2e1	SMART
EGF	737	765	9.63e0	SMART
EGF	768	796	1.25e1	SMART
EGF	799	831	1.4e0	SMART
low complexity region	1458	1474	N/A	INTRINSIC
low complexity region	2218	2229	N/A	INTRINSIC
Pfam:Tox-GHH	2679	2757	2e-34	PFAM

Meta Mutation Damage Score

0.0892

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.0%
20x: 94.2%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice homozygous for a null allele show abnormalities in the laterality and mapping of ipsilateral retinal projections that lead to loss of ipsilateral drive, defects in binocular vision, and impaired performance on a visual discrimination task. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 115 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700006A11Rik	A	T	3: 124,416,833	H143Q	probably benign	Het
Abca3	C	T	17: 24,374,300	R224C	probably damaging	Het
Adcy8	A	T	15: 64,787,358	W528R	probably damaging	Het
Agbl1	A	G	7: 76,421,917	E329G	probably damaging	Het
Agbl5	G	A	5: 30,903,059	R141Q	probably damaging	Het
Ampd2	A	T	3: 108,079,233	M245K	probably damaging	Het
Apob	G	A	12: 8,005,219		probably null	Het
Apool	C	T	X: 112,349,843	Q60*	probably null	Het
Aqp1	A	T	6: 55,345,535	I172F	probably damaging	Het
Atp7a	A	G	X: 106,109,768	D1092G	probably benign	Het
Ccdc114	T	A	7: 45,929,090	M29K	probably benign	Het
Ccdc83	A	T	7: 90,250,529	F45Y	probably damaging	Het
Cct8l1	G	A	5: 25,516,883	V199I	probably benign	Het
Cdc23	C	A	18: 34,651,689	V7L	unknown	Het
Cdc25a	T	A	9: 109,884,140	C227S	possibly damaging	Het
Ces1a	A	G	8: 93,032,675	S278P	possibly damaging	Het
Cfap65	A	T	1: 74,922,978	S695T	probably benign	Het
Col13a1	A	G	10: 61,874,018		silent	Het
Ctps	A	T	4: 120,553,973	L282Q	probably damaging	Het
Cyp2a22	A	T	7: 26,932,481	F450Y	probably benign	Het
Cyp2d10	C	T	15: 82,403,753	R383H	probably benign	Het
Dennd3	G	A	15: 73,547,295	R645H	probably damaging	Het
Dnaaf5	G	T	5: 139,174,207	R620L	probably damaging	Het
Dnah11	A	T	12: 118,082,453	L1750*	probably null	Het
Dnah9	A	G	11: 65,850,040	F4107L	probably damaging	Het
Dnaja3	A	T	16: 4,696,425	T274S	probably damaging	Het
Dot1l	A	G	10: 80,784,646	D514G	possibly damaging	Het
Dst	A	C	1: 34,295,263	K4857N	probably damaging	Het
Dysf	A	T	6: 84,137,272	K1226M	probably damaging	Het
Enpep	T	A	3: 129,303,755	Q409L	probably damaging	Het
Fign	A	T	2: 63,979,693	L411*	probably null	Het
Flt1	C	A	5: 147,683,939	A132S	probably benign	Het
Fryl	G	A	5: 73,074,767	P1550L	probably damaging	Het
Gas2l3	CACTCGTCATACT	CACT	10: 89,430,958		probably benign	Het
H2afb3	T	C	X: 120,312,846	T84A	probably damaging	Het
Hal	A	T	10: 93,514,042	I555F	probably damaging	Het
Hibadh	C	T	6: 52,620,094	V122M	possibly damaging	Het
Hsd3b3	T	C	3: 98,742,024	T328A	possibly damaging	Het
Ifi44	T	C	3: 151,749,632		probably benign	Het
Ifi47	A	G	11: 49,095,534	T43A	probably benign	Het
Inf2	A	T	12: 112,612,039		probably null	Het
Itga10	C	T	3: 96,652,211	Q475*	probably null	Het
Itga6	T	A	2: 71,826,435	D344E	probably benign	Het
Kcnmb4	T	C	10: 116,473,197	T109A	probably benign	Het
Kif19a	G	A	11: 114,767,227	M37I	probably benign	Het
Kiss1r	C	A	10: 79,918,762	S30*	probably null	Het
Lrrc66	G	A	5: 73,608,011	P563L	probably damaging	Het
Mamdc2	T	C	19: 23,378,796	D96G	probably benign	Het
Map3k12	A	T	15: 102,501,832		probably null	Het
Mc3r	A	T	2: 172,249,613	I252F	possibly damaging	Het
Metrn	C	T	17: 25,796,639	G34D	probably damaging	Het
Mipep	A	G	14: 60,809,013	E328G	probably benign	Het
Mkl1	A	G	15: 81,022,426	V91A	probably damaging	Het
Muc5b	A	T	7: 141,859,262	T1982S	unknown	Het
Myh8	A	T	11: 67,305,916	T1792S	possibly damaging	Het
Myo1a	T	C	10: 127,707,419		probably null	Het
Myo5a	T	A	9: 75,174,156	S1008T	probably benign	Het
Ncald	A	T	15: 37,397,234	H67Q	probably damaging	Het
Nudt5	T	A	2: 5,864,387	H141Q	probably benign	Het
Numbl	G	A	7: 27,280,990	D466N	probably damaging	Het
Nup210	T	A	6: 91,055,327	I20F	probably benign	Het
Olfr1100	A	T	2: 86,978,322	V158D	possibly damaging	Het
Olfr1335	A	C	4: 118,808,860	W319G	possibly damaging	Het
Olfr310	A	G	7: 86,269,591	I66T	probably damaging	Het
Olfr606	A	T	7: 103,451,410	E24D	probably benign	Het
Olfr668	A	C	7: 104,925,493	N90K	probably benign	Het
Olfr675	A	T	7: 105,024,053	M309K	probably benign	Het
Olfr763	T	C	10: 129,011,344	Y20H	possibly damaging	Het
Olfr871	A	T	9: 20,212,582	I78F	possibly damaging	Het
Papolg	G	A	11: 23,867,331	T153I	possibly damaging	Het
Pappa	A	G	4: 65,205,128	H900R	probably benign	Het
Pcdh17	T	C	14: 84,533,342	S1087P	probably benign	Het
Phf11a	T	G	14: 59,284,400	L107F	possibly damaging	Het
Phlpp2	A	T	8: 109,925,829	I602F	probably damaging	Het
Pik3c2g	T	A	6: 139,720,147	C65S	probably null	Het
Pilra	A	G	5: 137,835,412	F131L	probably damaging	Het
Pomt2	A	C	12: 87,133,460	C256G	probably damaging	Het
Ppl	A	T	16: 5,088,878	S1184R	probably benign	Het
Prkaa1	G	T	15: 5,176,911	R416L	possibly damaging	Het
Prkdc	C	A	16: 15,772,048	R2592S	probably damaging	Het
Prmt2	C	T	10: 76,222,556	V140I	probably damaging	Het
Prodh	A	T	16: 18,077,789		probably null	Het
Psg29	T	A	7: 17,211,838	D444E	probably damaging	Het
Ptgs1	A	T	2: 36,251,260	N573I	probably damaging	Het
Rbm38	C	T	2: 173,022,082	P15S	probably benign	Het
Riox2	T	C	16: 59,491,873	S458P	possibly damaging	Het
Rnase4	T	C	14: 51,105,245	V142A	possibly damaging	Het
Rnf138	A	G	18: 21,026,147	N244S	probably benign	Het
Rnf40	T	C	7: 127,597,286	L802P	probably damaging	Het
Sfxn4	C	T	19: 60,851,012	V203M	probably damaging	Het
Skor2	G	T	18: 76,858,954	E124*	probably null	Het
Slc4a2	G	A	5: 24,438,762	S855N	probably benign	Het
Slc8a2	T	C	7: 16,150,583	L626P	possibly damaging	Het
Slco4c1	G	A	1: 96,841,228	P303L	probably damaging	Het
Slirp	A	G	12: 87,444,014	T29A	probably damaging	Het
Snrpd3	G	T	10: 75,519,393	C20F	possibly damaging	Het
Spag17	T	A	3: 100,080,118	Y1575N	possibly damaging	Het
St8sia4	G	A	1: 95,667,185	A26V	probably benign	Het
Stab2	A	T	10: 86,863,558	I481N	probably benign	Het
Tgm1	A	G	14: 55,709,935	V323A	probably damaging	Het
Tmco4	A	G	4: 139,058,122	H501R	probably damaging	Het
Tob1	A	T	11: 94,213,741	R34S	possibly damaging	Het
Trhr2	C	T	8: 122,357,371	V297I	probably benign	Het
Trim30d	A	C	7: 104,487,958	V13G	probably damaging	Het
Trpm3	T	C	19: 22,885,349	V485A	possibly damaging	Het
Trrap	T	C	5: 144,851,179	I3518T	probably damaging	Het
Ttc27	T	C	17: 74,747,755	L352P	probably damaging	Het
Ush1g	A	G	11: 115,318,297	L357P	possibly damaging	Het
Usp24	A	G	4: 106,420,447	H2258R	probably benign	Het
Vcam1	A	G	3: 116,124,388	V308A	probably damaging	Het
Vdr	A	G	15: 97,857,578	S355P	probably benign	Het
Vldlr	T	C	19: 27,238,277	S184P	probably damaging	Het
Xpo4	C	A	14: 57,584,641	A1073S	probably benign	Het
Zfand2b	A	G	1: 75,170,990	D224G	probably benign	Het
Zfp263	A	G	16: 3,746,840	R240G	possibly damaging	Het

Other mutations in Tenm2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00161:Tenm2	APN	11	36206899	splice site	probably benign
IGL00834:Tenm2	APN	11	36024258	missense	probably damaging	1.00
IGL00911:Tenm2	APN	11	36008733	nonsense	probably null
IGL00937:Tenm2	APN	11	36024623	missense	probably damaging	1.00
IGL01154:Tenm2	APN	11	36041544	missense	probably damaging	1.00
IGL01313:Tenm2	APN	11	36024248	missense	probably damaging	0.98
IGL01346:Tenm2	APN	11	36027405	nonsense	probably null
IGL01539:Tenm2	APN	11	36106827	missense	possibly damaging	0.89
IGL01629:Tenm2	APN	11	36864884	missense	probably damaging	0.98
IGL01780:Tenm2	APN	11	36046941	missense	probably benign
IGL01821:Tenm2	APN	11	36023883	missense	probably damaging	0.98
IGL01988:Tenm2	APN	11	36027251	missense	probably damaging	1.00
IGL02002:Tenm2	APN	11	36207095	missense	probably benign
IGL02449:Tenm2	APN	11	36023622	missense	probably damaging	0.99
IGL02505:Tenm2	APN	11	36051916	nonsense	probably null
IGL02649:Tenm2	APN	11	36207085	missense	possibly damaging	0.85
IGL02688:Tenm2	APN	11	36068458	missense	probably benign	0.05
IGL02801:Tenm2	APN	11	36047030	nonsense	probably null
IGL02928:Tenm2	APN	11	36027170	missense	possibly damaging	0.69
IGL02940:Tenm2	APN	11	36041644	missense	probably damaging	1.00
IGL03202:Tenm2	APN	11	36024548	missense	probably damaging	1.00
IGL03213:Tenm2	APN	11	36023330	missense	probably benign	0.05
IGL03276:Tenm2	APN	11	36072776	missense	possibly damaging	0.95
IGL03296:Tenm2	APN	11	36052025	splice site	probably null
IGL03381:Tenm2	APN	11	36068411	missense	probably benign	0.01
IGL03398:Tenm2	APN	11	36024543	missense	probably damaging	1.00
browser	UTSW	11	36046765	critical splice donor site	probably null
mosaic	UTSW	11	36063775	critical splice donor site	probably null
IGL02799:Tenm2	UTSW	11	36273408	missense	probably damaging	1.00
PIT4260001:Tenm2	UTSW	11	36163730	missense	probably damaging	1.00
PIT4382001:Tenm2	UTSW	11	36063902	missense	probably damaging	0.99
R0004:Tenm2	UTSW	11	36023357	missense	probably damaging	1.00
R0420:Tenm2	UTSW	11	36207124	splice site	probably benign
R0537:Tenm2	UTSW	11	36163730	missense	probably damaging	1.00
R0599:Tenm2	UTSW	11	36024780	missense	possibly damaging	0.93
R0636:Tenm2	UTSW	11	36943976	missense	probably damaging	1.00
R0693:Tenm2	UTSW	11	36024809	missense	probably damaging	1.00
R0991:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R0992:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1167:Tenm2	UTSW	11	36864684	missense	probably benign	0.30
R1177:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1178:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1179:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1180:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1181:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1193:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1194:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1195:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1195:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1195:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1259:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1265:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1267:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1268:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1269:Tenm2	UTSW	11	36008358	missense	possibly damaging	0.64
R1270:Tenm2	UTSW	11	36041659	missense	probably damaging	1.00
R1272:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1273:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1311:Tenm2	UTSW	11	36068594	splice site	probably benign
R1374:Tenm2	UTSW	11	36008454	missense	probably benign	0.00
R1542:Tenm2	UTSW	11	36300220	missense	probably damaging	0.99
R1573:Tenm2	UTSW	11	36047069	missense	probably damaging	1.00
R1579:Tenm2	UTSW	11	36106783	missense	probably damaging	1.00
R1697:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1722:Tenm2	UTSW	11	36008103	missense	probably damaging	1.00
R1756:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1793:Tenm2	UTSW	11	36023382	missense	probably damaging	0.99
R1950:Tenm2	UTSW	11	36063177	missense	possibly damaging	0.94
R1954:Tenm2	UTSW	11	36047547	missense	possibly damaging	0.87
R2025:Tenm2	UTSW	11	36047264	nonsense	probably null
R2117:Tenm2	UTSW	11	36024854	missense	probably damaging	1.00
R2244:Tenm2	UTSW	11	36864862	missense	probably damaging	0.98
R2298:Tenm2	UTSW	11	36046777	missense	possibly damaging	0.62
R2432:Tenm2	UTSW	11	36027191	missense	probably damaging	1.00
R3014:Tenm2	UTSW	11	36023973	missense	probably damaging	1.00
R3115:Tenm2	UTSW	11	36023366	missense	probably damaging	1.00
R3684:Tenm2	UTSW	11	36051817	missense	probably benign	0.00
R3685:Tenm2	UTSW	11	36051817	missense	probably benign	0.00
R3705:Tenm2	UTSW	11	36068326	missense	probably damaging	0.97
R3820:Tenm2	UTSW	11	36024320	missense	probably damaging	0.98
R3821:Tenm2	UTSW	11	36024320	missense	probably damaging	0.98
R3822:Tenm2	UTSW	11	36024320	missense	probably damaging	0.98
R3844:Tenm2	UTSW	11	36047538	missense	probably damaging	0.98
R3878:Tenm2	UTSW	11	36139574	critical splice donor site	probably null
R4019:Tenm2	UTSW	11	36047074	missense	probably benign	0.04
R4062:Tenm2	UTSW	11	36008655	missense	probably damaging	1.00
R4367:Tenm2	UTSW	11	36027398	missense	probably benign
R4395:Tenm2	UTSW	11	36024624	missense	probably benign	0.23
R4508:Tenm2	UTSW	11	36008345	missense	possibly damaging	0.82
R4534:Tenm2	UTSW	11	36063104	missense	possibly damaging	0.64
R4539:Tenm2	UTSW	11	36046780	missense	probably damaging	1.00
R4644:Tenm2	UTSW	11	36047136	missense	probably benign	0.00
R4661:Tenm2	UTSW	11	36024448	missense	probably damaging	0.99
R4669:Tenm2	UTSW	11	36010487	missense	probably damaging	1.00
R4687:Tenm2	UTSW	11	36049097	missense	probably benign
R4711:Tenm2	UTSW	11	36300212	missense	probably damaging	0.98
R4816:Tenm2	UTSW	11	36027290	missense	probably damaging	1.00
R4843:Tenm2	UTSW	11	36024020	missense	probably damaging	1.00
R4850:Tenm2	UTSW	11	36023488	nonsense	probably null
R4870:Tenm2	UTSW	11	36078569	missense	probably damaging	1.00
R5058:Tenm2	UTSW	11	36207080	missense	possibly damaging	0.80
R5071:Tenm2	UTSW	11	36068381	missense	probably damaging	0.99
R5073:Tenm2	UTSW	11	36068381	missense	probably damaging	0.99
R5081:Tenm2	UTSW	11	36024633	missense	possibly damaging	0.95
R5093:Tenm2	UTSW	11	36944162	missense	probably damaging	1.00
R5170:Tenm2	UTSW	11	36024806	missense	probably damaging	0.98
R5253:Tenm2	UTSW	11	36047201	nonsense	probably null
R5343:Tenm2	UTSW	11	36069503	missense	probably benign	0.00
R5493:Tenm2	UTSW	11	36864676	missense	probably benign	0.01
R5600:Tenm2	UTSW	11	36163714	splice site	probably null
R5677:Tenm2	UTSW	11	36141683	missense	probably damaging	0.98
R5703:Tenm2	UTSW	11	36023799	missense	probably benign	0.34
R5707:Tenm2	UTSW	11	36047182	missense	possibly damaging	0.79
R6026:Tenm2	UTSW	11	36072729	critical splice donor site	probably null
R6063:Tenm2	UTSW	11	36163717	critical splice donor site	probably null
R6086:Tenm2	UTSW	11	36008646	missense	possibly damaging	0.64
R6151:Tenm2	UTSW	11	36008783	missense	probably damaging	1.00
R6169:Tenm2	UTSW	11	36139690	missense	probably damaging	0.99
R6193:Tenm2	UTSW	11	36046794	missense	probably damaging	1.00
R6405:Tenm2	UTSW	11	36864859	missense	probably benign	0.44
R6477:Tenm2	UTSW	11	36010507	critical splice acceptor site	probably null
R6607:Tenm2	UTSW	11	36063775	critical splice donor site	probably null
R6668:Tenm2	UTSW	11	36046765	critical splice donor site	probably null
R6825:Tenm2	UTSW	11	36046884	missense	probably benign	0.02
R6885:Tenm2	UTSW	11	36023580	missense	possibly damaging	0.95
R7017:Tenm2	UTSW	11	36171409	missense	probably damaging	0.98
R7115:Tenm2	UTSW	11	36163817	missense	probably damaging	0.99
R7153:Tenm2	UTSW	11	36024182	missense	probably damaging	0.98
R7173:Tenm2	UTSW	11	36041551	missense	probably damaging	0.99
R7199:Tenm2	UTSW	11	36171436	missense	probably damaging	1.00
R7205:Tenm2	UTSW	11	36049129	missense	probably damaging	0.99
R7250:Tenm2	UTSW	11	36072798	missense	probably damaging	1.00
R7290:Tenm2	UTSW	11	36023471	missense	probably damaging	1.00
R7366:Tenm2	UTSW	11	36069414	missense	probably benign	0.09
R7432:Tenm2	UTSW	11	36864941	missense	probably benign
R7504:Tenm2	UTSW	11	36139743	missense	probably damaging	1.00
R7513:Tenm2	UTSW	11	36051900	missense	probably benign	0.34
R7523:Tenm2	UTSW	11	36078581	splice site	probably null
R7527:Tenm2	UTSW	11	36206976	missense	probably damaging	1.00
R7648:Tenm2	UTSW	11	36106736	missense	probably damaging	1.00
R7653:Tenm2	UTSW	11	36047347	missense	probably benign	0.09
R7717:Tenm2	UTSW	11	36864935	missense	probably damaging	0.97
R7739:Tenm2	UTSW	11	36069561	missense	possibly damaging	0.50
R7762:Tenm2	UTSW	11	36023306	missense	possibly damaging	0.74
R7786:Tenm2	UTSW	11	36010449	missense	probably damaging	0.99
R7803:Tenm2	UTSW	11	36047116	missense	probably damaging	0.98
R7834:Tenm2	UTSW	11	36024854	missense	probably damaging	1.00
R7838:Tenm2	UTSW	11	36106799	missense	probably benign	0.02
R8073:Tenm2	UTSW	11	36139644	missense	possibly damaging	0.56
R8076:Tenm2	UTSW	11	36027221	missense	probably benign	0.23
R8109:Tenm2	UTSW	11	36008310	missense	probably benign
R8306:Tenm2	UTSW	11	36069369	missense	possibly damaging	0.52
R8352:Tenm2	UTSW	11	36023601	missense	probably damaging	0.98
R8452:Tenm2	UTSW	11	36023601	missense	probably damaging	0.98
R8864:Tenm2	UTSW	11	36027195	missense	possibly damaging	0.95
R8880:Tenm2	UTSW	11	36051961	missense	probably damaging	0.99
R8943:Tenm2	UTSW	11	36944034	missense	probably damaging	0.98
R8969:Tenm2	UTSW	11	36051861	missense	probably damaging	0.99
R9168:Tenm2	UTSW	11	36039895	missense	probably damaging	1.00
R9279:Tenm2	UTSW	11	36068476	missense	probably benign	0.00
R9294:Tenm2	UTSW	11	36024500	missense	probably damaging	0.98
R9320:Tenm2	UTSW	11	36023647	missense	probably damaging	0.99
R9373:Tenm2	UTSW	11	36039886	missense	probably damaging	1.00
R9408:Tenm2	UTSW	11	36069419	missense	probably damaging	1.00
R9410:Tenm2	UTSW	11	36141569	missense	probably damaging	0.99
R9454:Tenm2	UTSW	11	36221459	missense	probably benign
R9489:Tenm2	UTSW	11	36943964	missense	probably damaging	0.99
R9711:Tenm2	UTSW	11	36024514	missense	probably damaging	0.99
RF021:Tenm2	UTSW	11	36024203	missense	possibly damaging	0.95
X0018:Tenm2	UTSW	11	36024200	missense	probably damaging	1.00
X0063:Tenm2	UTSW	11	36024730	missense	probably benign
Z1088:Tenm2	UTSW	11	36273267	missense	probably damaging	1.00
Z1177:Tenm2	UTSW	11	36008234	missense	possibly damaging	0.95
Z1177:Tenm2	UTSW	11	36300335	missense	probably damaging	0.98
Z1177:Tenm2	UTSW	11	36385130	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- GCACTTAGCATGGCTTCCTG -3'
(R):5'- TGAAGCTCCGTTATCTCAGC -3'

Sequencing Primer
(F):5'- TCTTGGGCCTATACTGGAACATAAGG -3'
(R):5'- TATCTCAGCTCTAGAACTGCAGGG -3'

Posted On

2016-06-06