Incidental Mutation 'R0426:Hgd'
ID38688
Institutional Source Beutler Lab
Gene Symbol Hgd
Ensembl Gene ENSMUSG00000022821
Gene Namehomogentisate 1, 2-dioxygenase
Synonyms
MMRRC Submission 038628-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0426 (G1)
Quality Score211
Status Validated
Chromosome16
Chromosomal Location37580153-37632020 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 37588685 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000125492 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000159787] [ENSMUST00000160847]
Predicted Effect probably benign
Transcript: ENSMUST00000159787
Predicted Effect probably benign
Transcript: ENSMUST00000160847
SMART Domains Protein: ENSMUSP00000125492
Gene: ENSMUSG00000022821

DomainStartEndE-ValueType
Pfam:HgmA 5 434 2e-225 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161193
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162918
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231668
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.9%
Validation Efficiency 96% (86/90)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the enzyme homogentisate 1,2 dioxygenase. This enzyme is involved in the catabolism of the amino acids tyrosine and phenylalanine. Mutations in this gene are the cause of the autosomal recessive metabolism disorder alkaptonuria.[provided by RefSeq, May 2010]
PHENOTYPE: Mutations in this gene result in high levels of urinary homogentisic acid. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830010M20Rik C T 5: 107,510,373 T1603I probably damaging Het
Abca8b G T 11: 109,955,027 probably benign Het
Acadl A T 1: 66,841,646 F320L probably damaging Het
Acsbg1 T C 9: 54,622,746 D222G probably benign Het
Anapc15 A G 7: 101,898,033 T39A probably benign Het
Ano3 A T 2: 110,661,174 V919E probably damaging Het
Arhgef12 T C 9: 42,970,990 probably null Het
Atad5 T A 11: 80,112,832 I1091N probably benign Het
Atf1 A T 15: 100,232,827 H26L possibly damaging Het
Atp10a T C 7: 58,784,734 M252T probably benign Het
Cd55 C T 1: 130,448,372 R347H probably benign Het
Cdc27 A C 11: 104,513,027 probably null Het
Cdh9 G A 15: 16,823,454 probably null Het
Cdk11b T C 4: 155,642,512 probably benign Het
Cep70 A G 9: 99,297,684 D567G probably benign Het
Cep78 A T 19: 15,970,970 Y382* probably null Het
Col9a2 T C 4: 121,044,660 probably benign Het
Cyp2d12 G A 15: 82,558,963 D409N probably benign Het
Ddx39 A G 8: 83,721,769 T217A probably benign Het
Dennd1b T A 1: 139,170,196 D733E probably benign Het
Dicer1 A G 12: 104,702,542 S1294P probably damaging Het
Dnah3 T C 7: 119,943,572 E3539G probably benign Het
Dnmbp A G 19: 43,852,436 probably benign Het
Dysf T C 6: 84,149,757 L1332P probably damaging Het
F5 A G 1: 164,182,840 D380G probably damaging Het
Fam160a2 A C 7: 105,389,473 C186W probably damaging Het
Fam171a1 T C 2: 3,225,396 V522A probably benign Het
Galr2 C A 11: 116,281,691 A69D probably damaging Het
Grk2 T C 19: 4,290,600 probably null Het
Gtf3c1 A T 7: 125,663,016 Y1119* probably null Het
Ildr2 G T 1: 166,308,899 V436L probably benign Het
Intu G A 3: 40,675,305 C355Y probably damaging Het
Irf2bpl G T 12: 86,883,096 P268T probably benign Het
Jarid2 T C 13: 44,840,882 probably null Het
Jup A T 11: 100,372,401 M716K probably benign Het
Kank1 G A 19: 25,411,473 V809I probably damaging Het
Kdm1b T A 13: 47,064,244 probably benign Het
Kdm3a C T 6: 71,600,755 C687Y probably damaging Het
Kdm5d T A Y: 942,437 probably benign Het
Kifap3 T A 1: 163,865,552 probably benign Het
Macf1 T A 4: 123,483,660 K1400* probably null Het
Majin A G 19: 6,212,117 probably benign Het
Mb21d1 G A 9: 78,435,738 probably benign Het
Mctp1 A G 13: 77,020,821 I846V probably benign Het
Mrgpra2b T A 7: 47,464,127 I286F possibly damaging Het
Neil3 T G 8: 53,609,396 probably benign Het
Nox3 G T 17: 3,695,563 N23K probably damaging Het
Nt5c3 T C 6: 56,883,812 K219E probably benign Het
Olfr1458 G A 19: 13,103,278 R3C possibly damaging Het
Olfr213 A T 6: 116,540,485 N11Y probably damaging Het
Olfr389 T A 11: 73,776,437 M297L probably benign Het
Olfr524 A C 7: 140,202,116 F218C possibly damaging Het
Olfr548-ps1 T A 7: 102,542,686 I250N probably damaging Het
Olfr954 T C 9: 39,461,593 L54P probably damaging Het
Pacsin2 A G 15: 83,379,795 V347A possibly damaging Het
Pcdhb7 A T 18: 37,342,804 E331V probably damaging Het
Pcid2 A C 8: 13,081,262 probably null Het
Pcsk9 T C 4: 106,450,077 D323G possibly damaging Het
Pdhb T C 14: 8,169,801 E203G probably damaging Het
Phlpp2 A G 8: 109,928,463 Y630C probably benign Het
Pidd1 C T 7: 141,439,133 A812T probably damaging Het
Plau G A 14: 20,842,314 R389H probably benign Het
Plekhg6 G A 6: 125,364,629 probably null Het
Ppox T C 1: 171,277,749 Y321C probably damaging Het
Pxdn A G 12: 29,987,066 N281S possibly damaging Het
Pycrl A T 15: 75,918,388 M138K probably benign Het
Radil T C 5: 142,497,873 Y526C probably damaging Het
Ranbp3 C A 17: 56,707,169 D233E probably benign Het
Rhpn1 A G 15: 75,711,872 Q402R possibly damaging Het
Sec23b T A 2: 144,568,612 probably benign Het
Sel1l2 A T 2: 140,240,912 L602* probably null Het
Sema5b G A 16: 35,646,355 G209D probably damaging Het
Svep1 T C 4: 58,073,333 Y1992C possibly damaging Het
Syncrip T A 9: 88,456,259 probably benign Het
Synj1 G T 16: 90,967,354 A65E probably damaging Het
Taar2 G A 10: 23,941,495 R311H probably benign Het
Tecrl T C 5: 83,354,763 probably benign Het
Tenm4 G T 7: 96,777,851 G698C probably damaging Het
Tmem209 G A 6: 30,491,182 L259F probably damaging Het
Tmem247 G A 17: 86,918,503 E124K possibly damaging Het
Tnks2 C A 19: 36,852,821 A218E probably damaging Het
Tppp T A 13: 74,021,311 F57I probably damaging Het
Trim36 A G 18: 46,172,525 W452R probably damaging Het
Vars2 A T 17: 35,664,584 V262E probably damaging Het
Vmn2r92 C T 17: 18,167,957 A408V probably damaging Het
Zfp516 G T 18: 82,955,772 A32S probably benign Het
Zfy2 G T Y: 2,107,348 L429I possibly damaging Het
Other mutations in Hgd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00777:Hgd APN 16 37613249 missense probably damaging 1.00
IGL00851:Hgd APN 16 37631695 missense probably damaging 0.98
IGL01339:Hgd APN 16 37631730 missense possibly damaging 0.72
IGL01627:Hgd APN 16 37621925 missense probably damaging 0.96
IGL02565:Hgd APN 16 37615387 missense possibly damaging 0.88
IGL03098:Hgd UTSW 16 37616245 missense probably benign 0.44
R0346:Hgd UTSW 16 37588774 splice site probably benign
R0360:Hgd UTSW 16 37611184 splice site probably benign
R0799:Hgd UTSW 16 37628609 splice site probably benign
R1178:Hgd UTSW 16 37615394 missense possibly damaging 0.95
R2921:Hgd UTSW 16 37618968 missense probably damaging 1.00
R2922:Hgd UTSW 16 37618968 missense probably damaging 1.00
R4791:Hgd UTSW 16 37631825 makesense probably null
R4859:Hgd UTSW 16 37588749 missense probably damaging 1.00
R5289:Hgd UTSW 16 37628551 missense possibly damaging 0.94
R5368:Hgd UTSW 16 37589751 missense probably benign 0.33
R5779:Hgd UTSW 16 37593371 missense probably benign 0.01
R6140:Hgd UTSW 16 37589713 missense probably benign 0.04
R6160:Hgd UTSW 16 37613298 missense probably damaging 1.00
R6636:Hgd UTSW 16 37615374 missense possibly damaging 0.75
R7196:Hgd UTSW 16 37588716 missense probably benign 0.03
R7450:Hgd UTSW 16 37624324 missense possibly damaging 0.88
R7580:Hgd UTSW 16 37618879 missense possibly damaging 0.67
R7720:Hgd UTSW 16 37593435 missense probably benign
Z1177:Hgd UTSW 16 37589719 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGATACATGCCCTTGTGGCTATTCTTG -3'
(R):5'- TGGAAATGGGACAGTTCACCTGC -3'

Sequencing Primer
(F):5'- ggaagatgtagagtcagcgag -3'
(R):5'- GGACAGTTCACCTGCTAAATTTGAAG -3'
Posted On2013-05-23