Incidental Mutation 'R5074:Vdr'
ID386884
Institutional Source Beutler Lab
Gene Symbol Vdr
Ensembl Gene ENSMUSG00000022479
Gene Namevitamin D (1,25-dihydroxyvitamin D3) receptor
SynonymsNr1i1
MMRRC Submission 042663-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5074 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location97854425-97910630 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 97857578 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 355 (S355P)
Ref Sequence ENSEMBL: ENSMUSP00000023119 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023119]
Predicted Effect probably benign
Transcript: ENSMUST00000023119
AA Change: S355P

PolyPhen 2 Score 0.350 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000023119
Gene: ENSMUSG00000022479
AA Change: S355P

DomainStartEndE-ValueType
ZnF_C4 21 92 1.4e-34 SMART
low complexity region 102 114 N/A INTRINSIC
low complexity region 173 182 N/A INTRINSIC
HOLI 227 389 3.54e-36 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139656
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the nuclear hormone receptor for vitamin D3. This receptor also functions as a receptor for the secondary bile acid lithocholic acid. The receptor belongs to the family of trans-acting transcriptional regulatory factors and shows sequence similarity to the steroid and thyroid hormone receptors. Downstream targets of this nuclear hormone receptor are principally involved in mineral metabolism though the receptor regulates a variety of other metabolic pathways, such as those involved in the immune response and cancer. Mutations in this gene are associated with type II vitamin D-resistant rickets. A single nucleotide polymorphism in the initiation codon results in an alternate translation start site three codons downstream. Alternative splicing results in multiple transcript variants encoding different proteins. [provided by RefSeq, Feb 2011]
PHENOTYPE: Homozygous null mutants fail to thrive after weaning and may exhibit excess mortality. Postweaning mutant mice develop alopecia, hypocalcemia, infertility, and rickets. Mutant females exhibit uterine hypoplasia with impaired follicular development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 115 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik A T 3: 124,416,833 H143Q probably benign Het
Abca3 C T 17: 24,374,300 R224C probably damaging Het
Adcy8 A T 15: 64,787,358 W528R probably damaging Het
Agbl1 A G 7: 76,421,917 E329G probably damaging Het
Agbl5 G A 5: 30,903,059 R141Q probably damaging Het
Ampd2 A T 3: 108,079,233 M245K probably damaging Het
Apob G A 12: 8,005,219 probably null Het
Apool C T X: 112,349,843 Q60* probably null Het
Aqp1 A T 6: 55,345,535 I172F probably damaging Het
Atp7a A G X: 106,109,768 D1092G probably benign Het
Ccdc114 T A 7: 45,929,090 M29K probably benign Het
Ccdc83 A T 7: 90,250,529 F45Y probably damaging Het
Cct8l1 G A 5: 25,516,883 V199I probably benign Het
Cdc23 C A 18: 34,651,689 V7L unknown Het
Cdc25a T A 9: 109,884,140 C227S possibly damaging Het
Ces1a A G 8: 93,032,675 S278P possibly damaging Het
Cfap65 A T 1: 74,922,978 S695T probably benign Het
Col13a1 A G 10: 61,874,018 silent Het
Ctps A T 4: 120,553,973 L282Q probably damaging Het
Cyp2a22 A T 7: 26,932,481 F450Y probably benign Het
Cyp2d10 C T 15: 82,403,753 R383H probably benign Het
Dennd3 G A 15: 73,547,295 R645H probably damaging Het
Dnaaf5 G T 5: 139,174,207 R620L probably damaging Het
Dnah11 A T 12: 118,082,453 L1750* probably null Het
Dnah9 A G 11: 65,850,040 F4107L probably damaging Het
Dnaja3 A T 16: 4,696,425 T274S probably damaging Het
Dot1l A G 10: 80,784,646 D514G possibly damaging Het
Dst A C 1: 34,295,263 K4857N probably damaging Het
Dysf A T 6: 84,137,272 K1226M probably damaging Het
Enpep T A 3: 129,303,755 Q409L probably damaging Het
Fign A T 2: 63,979,693 L411* probably null Het
Flt1 C A 5: 147,683,939 A132S probably benign Het
Fryl G A 5: 73,074,767 P1550L probably damaging Het
Gas2l3 CACTCGTCATACT CACT 10: 89,430,958 probably benign Het
H2afb3 T C X: 120,312,846 T84A probably damaging Het
Hal A T 10: 93,514,042 I555F probably damaging Het
Hibadh C T 6: 52,620,094 V122M possibly damaging Het
Hsd3b3 T C 3: 98,742,024 T328A possibly damaging Het
Ifi44 T C 3: 151,749,632 probably benign Het
Ifi47 A G 11: 49,095,534 T43A probably benign Het
Inf2 A T 12: 112,612,039 probably null Het
Itga10 C T 3: 96,652,211 Q475* probably null Het
Itga6 T A 2: 71,826,435 D344E probably benign Het
Kcnmb4 T C 10: 116,473,197 T109A probably benign Het
Kif19a G A 11: 114,767,227 M37I probably benign Het
Kiss1r C A 10: 79,918,762 S30* probably null Het
Lrrc66 G A 5: 73,608,011 P563L probably damaging Het
Mamdc2 T C 19: 23,378,796 D96G probably benign Het
Map3k12 A T 15: 102,501,832 probably null Het
Mc3r A T 2: 172,249,613 I252F possibly damaging Het
Metrn C T 17: 25,796,639 G34D probably damaging Het
Mipep A G 14: 60,809,013 E328G probably benign Het
Mkl1 A G 15: 81,022,426 V91A probably damaging Het
Muc5b A T 7: 141,859,262 T1982S unknown Het
Myh8 A T 11: 67,305,916 T1792S possibly damaging Het
Myo1a T C 10: 127,707,419 probably null Het
Myo5a T A 9: 75,174,156 S1008T probably benign Het
Ncald A T 15: 37,397,234 H67Q probably damaging Het
Nudt5 T A 2: 5,864,387 H141Q probably benign Het
Numbl G A 7: 27,280,990 D466N probably damaging Het
Nup210 T A 6: 91,055,327 I20F probably benign Het
Olfr1100 A T 2: 86,978,322 V158D possibly damaging Het
Olfr1335 A C 4: 118,808,860 W319G possibly damaging Het
Olfr310 A G 7: 86,269,591 I66T probably damaging Het
Olfr606 A T 7: 103,451,410 E24D probably benign Het
Olfr668 A C 7: 104,925,493 N90K probably benign Het
Olfr675 A T 7: 105,024,053 M309K probably benign Het
Olfr763 T C 10: 129,011,344 Y20H possibly damaging Het
Olfr871 A T 9: 20,212,582 I78F possibly damaging Het
Papolg G A 11: 23,867,331 T153I possibly damaging Het
Pappa A G 4: 65,205,128 H900R probably benign Het
Pcdh17 T C 14: 84,533,342 S1087P probably benign Het
Phf11a T G 14: 59,284,400 L107F possibly damaging Het
Phlpp2 A T 8: 109,925,829 I602F probably damaging Het
Pik3c2g T A 6: 139,720,147 C65S probably null Het
Pilra A G 5: 137,835,412 F131L probably damaging Het
Pomt2 A C 12: 87,133,460 C256G probably damaging Het
Ppl A T 16: 5,088,878 S1184R probably benign Het
Prkaa1 G T 15: 5,176,911 R416L possibly damaging Het
Prkdc C A 16: 15,772,048 R2592S probably damaging Het
Prmt2 C T 10: 76,222,556 V140I probably damaging Het
Prodh A T 16: 18,077,789 probably null Het
Psg29 T A 7: 17,211,838 D444E probably damaging Het
Ptgs1 A T 2: 36,251,260 N573I probably damaging Het
Rbm38 C T 2: 173,022,082 P15S probably benign Het
Riox2 T C 16: 59,491,873 S458P possibly damaging Het
Rnase4 T C 14: 51,105,245 V142A possibly damaging Het
Rnf138 A G 18: 21,026,147 N244S probably benign Het
Rnf40 T C 7: 127,597,286 L802P probably damaging Het
Sfxn4 C T 19: 60,851,012 V203M probably damaging Het
Skor2 G T 18: 76,858,954 E124* probably null Het
Slc4a2 G A 5: 24,438,762 S855N probably benign Het
Slc8a2 T C 7: 16,150,583 L626P possibly damaging Het
Slco4c1 G A 1: 96,841,228 P303L probably damaging Het
Slirp A G 12: 87,444,014 T29A probably damaging Het
Snrpd3 G T 10: 75,519,393 C20F possibly damaging Het
Spag17 T A 3: 100,080,118 Y1575N possibly damaging Het
St8sia4 G A 1: 95,667,185 A26V probably benign Het
Stab2 A T 10: 86,863,558 I481N probably benign Het
Tenm2 T A 11: 36,068,381 T1114S probably damaging Het
Tgm1 A G 14: 55,709,935 V323A probably damaging Het
Tmco4 A G 4: 139,058,122 H501R probably damaging Het
Tob1 A T 11: 94,213,741 R34S possibly damaging Het
Trhr2 C T 8: 122,357,371 V297I probably benign Het
Trim30d A C 7: 104,487,958 V13G probably damaging Het
Trpm3 T C 19: 22,885,349 V485A possibly damaging Het
Trrap T C 5: 144,851,179 I3518T probably damaging Het
Ttc27 T C 17: 74,747,755 L352P probably damaging Het
Ush1g A G 11: 115,318,297 L357P possibly damaging Het
Usp24 A G 4: 106,420,447 H2258R probably benign Het
Vcam1 A G 3: 116,124,388 V308A probably damaging Het
Vldlr T C 19: 27,238,277 S184P probably damaging Het
Xpo4 C A 14: 57,584,641 A1073S probably benign Het
Zfand2b A G 1: 75,170,990 D224G probably benign Het
Zfp263 A G 16: 3,746,840 R240G possibly damaging Het
Other mutations in Vdr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Vdr APN 15 97884854 missense probably damaging 1.00
IGL02813:Vdr APN 15 97869681 missense probably benign 0.45
yangshuo UTSW 15 97859121 missense probably damaging 1.00
R0400:Vdr UTSW 15 97869351 missense probably benign 0.00
R1102:Vdr UTSW 15 97859121 missense probably damaging 1.00
R1172:Vdr UTSW 15 97869333 missense probably benign 0.05
R1173:Vdr UTSW 15 97869333 missense probably benign 0.05
R1268:Vdr UTSW 15 97857475 missense probably benign 0.39
R1705:Vdr UTSW 15 97867171 missense probably damaging 1.00
R2879:Vdr UTSW 15 97859127 missense probably benign 0.01
R3030:Vdr UTSW 15 97857563 missense probably benign 0.00
R4695:Vdr UTSW 15 97858920 splice site probably null
R5710:Vdr UTSW 15 97859127 missense probably damaging 1.00
R5710:Vdr UTSW 15 97867208 missense probably benign 0.02
R5845:Vdr UTSW 15 97869766 missense possibly damaging 0.46
R5982:Vdr UTSW 15 97857596 missense probably benign 0.37
R6776:Vdr UTSW 15 97869828 missense probably damaging 1.00
R6865:Vdr UTSW 15 97857505 missense probably damaging 1.00
R7870:Vdr UTSW 15 97884890 missense possibly damaging 0.59
R7953:Vdr UTSW 15 97884890 missense possibly damaging 0.59
X0023:Vdr UTSW 15 97869818 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGGGGTGTGAGCTTCATGC -3'
(R):5'- GGAAGTACCTGGATACCAAAGC -3'

Sequencing Primer
(F):5'- CTGTTCTCCGGCTGGAAG -3'
(R):5'- CCCAGGAAAGGACTTGGTC -3'
Posted On2016-06-06