Incidental Mutation 'R5074:Prkdc'
ID386889
Institutional Source Beutler Lab
Gene Symbol Prkdc
Ensembl Gene ENSMUSG00000022672
Gene Nameprotein kinase, DNA activated, catalytic polypeptide
Synonymsslip, DOXNPH, DNA-PKcs, XRCC7, dxnph, DNA-PK, DNAPDcs
MMRRC Submission 042663-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.956) question?
Stock #R5074 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location15637866-15842235 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 15772048 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 2592 (R2592S)
Ref Sequence ENSEMBL: ENSMUSP00000023352 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023352]
Predicted Effect probably damaging
Transcript: ENSMUST00000023352
AA Change: R2592S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000023352
Gene: ENSMUSG00000022672
AA Change: R2592S

DomainStartEndE-ValueType
low complexity region 125 138 N/A INTRINSIC
low complexity region 1253 1263 N/A INTRINSIC
low complexity region 1508 1522 N/A INTRINSIC
NUC194 1810 2206 2.37e-246 SMART
SCOP:d1gw5a_ 2210 2493 5e-3 SMART
low complexity region 2669 2681 N/A INTRINSIC
low complexity region 2841 2855 N/A INTRINSIC
Pfam:FAT 3024 3470 8.2e-75 PFAM
PI3Kc 3749 4068 3.67e-86 SMART
FATC 4096 4128 1.57e-9 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the catalytic subunit of the DNA-dependent protein kinase (DNA-PK). It functions with the Ku70/Ku80 heterodimer protein in DNA double strand break repair and recombination. The protein encoded is a member of the PI3/PI4-kinase family.[provided by RefSeq, Jul 2010]
PHENOTYPE: Mutations at this locus effect genome stability, radiation sensitivity and DNA repair. Nonsense (scid) and null homozygotes have severe combined immunodeficiency. A BALB/c variant allele reduces enzyme activity and predisposes to breast cancer. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 115 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik A T 3: 124,416,833 H143Q probably benign Het
Abca3 C T 17: 24,374,300 R224C probably damaging Het
Adcy8 A T 15: 64,787,358 W528R probably damaging Het
Agbl1 A G 7: 76,421,917 E329G probably damaging Het
Agbl5 G A 5: 30,903,059 R141Q probably damaging Het
Ampd2 A T 3: 108,079,233 M245K probably damaging Het
Apob G A 12: 8,005,219 probably null Het
Apool C T X: 112,349,843 Q60* probably null Het
Aqp1 A T 6: 55,345,535 I172F probably damaging Het
Atp7a A G X: 106,109,768 D1092G probably benign Het
Ccdc114 T A 7: 45,929,090 M29K probably benign Het
Ccdc83 A T 7: 90,250,529 F45Y probably damaging Het
Cct8l1 G A 5: 25,516,883 V199I probably benign Het
Cdc23 C A 18: 34,651,689 V7L unknown Het
Cdc25a T A 9: 109,884,140 C227S possibly damaging Het
Ces1a A G 8: 93,032,675 S278P possibly damaging Het
Cfap65 A T 1: 74,922,978 S695T probably benign Het
Col13a1 A G 10: 61,874,018 silent Het
Ctps A T 4: 120,553,973 L282Q probably damaging Het
Cyp2a22 A T 7: 26,932,481 F450Y probably benign Het
Cyp2d10 C T 15: 82,403,753 R383H probably benign Het
Dennd3 G A 15: 73,547,295 R645H probably damaging Het
Dnaaf5 G T 5: 139,174,207 R620L probably damaging Het
Dnah11 A T 12: 118,082,453 L1750* probably null Het
Dnah9 A G 11: 65,850,040 F4107L probably damaging Het
Dnaja3 A T 16: 4,696,425 T274S probably damaging Het
Dot1l A G 10: 80,784,646 D514G possibly damaging Het
Dst A C 1: 34,295,263 K4857N probably damaging Het
Dysf A T 6: 84,137,272 K1226M probably damaging Het
Enpep T A 3: 129,303,755 Q409L probably damaging Het
Fign A T 2: 63,979,693 L411* probably null Het
Flt1 C A 5: 147,683,939 A132S probably benign Het
Fryl G A 5: 73,074,767 P1550L probably damaging Het
Gas2l3 CACTCGTCATACT CACT 10: 89,430,958 probably benign Het
H2afb3 T C X: 120,312,846 T84A probably damaging Het
Hal A T 10: 93,514,042 I555F probably damaging Het
Hibadh C T 6: 52,620,094 V122M possibly damaging Het
Hsd3b3 T C 3: 98,742,024 T328A possibly damaging Het
Ifi44 T C 3: 151,749,632 probably benign Het
Ifi47 A G 11: 49,095,534 T43A probably benign Het
Inf2 A T 12: 112,612,039 probably null Het
Itga10 C T 3: 96,652,211 Q475* probably null Het
Itga6 T A 2: 71,826,435 D344E probably benign Het
Kcnmb4 T C 10: 116,473,197 T109A probably benign Het
Kif19a G A 11: 114,767,227 M37I probably benign Het
Kiss1r C A 10: 79,918,762 S30* probably null Het
Lrrc66 G A 5: 73,608,011 P563L probably damaging Het
Mamdc2 T C 19: 23,378,796 D96G probably benign Het
Map3k12 A T 15: 102,501,832 probably null Het
Mc3r A T 2: 172,249,613 I252F possibly damaging Het
Metrn C T 17: 25,796,639 G34D probably damaging Het
Mipep A G 14: 60,809,013 E328G probably benign Het
Mkl1 A G 15: 81,022,426 V91A probably damaging Het
Muc5b A T 7: 141,859,262 T1982S unknown Het
Myh8 A T 11: 67,305,916 T1792S possibly damaging Het
Myo1a T C 10: 127,707,419 probably null Het
Myo5a T A 9: 75,174,156 S1008T probably benign Het
Ncald A T 15: 37,397,234 H67Q probably damaging Het
Nudt5 T A 2: 5,864,387 H141Q probably benign Het
Numbl G A 7: 27,280,990 D466N probably damaging Het
Nup210 T A 6: 91,055,327 I20F probably benign Het
Olfr1100 A T 2: 86,978,322 V158D possibly damaging Het
Olfr1335 A C 4: 118,808,860 W319G possibly damaging Het
Olfr310 A G 7: 86,269,591 I66T probably damaging Het
Olfr606 A T 7: 103,451,410 E24D probably benign Het
Olfr668 A C 7: 104,925,493 N90K probably benign Het
Olfr675 A T 7: 105,024,053 M309K probably benign Het
Olfr763 T C 10: 129,011,344 Y20H possibly damaging Het
Olfr871 A T 9: 20,212,582 I78F possibly damaging Het
Papolg G A 11: 23,867,331 T153I possibly damaging Het
Pappa A G 4: 65,205,128 H900R probably benign Het
Pcdh17 T C 14: 84,533,342 S1087P probably benign Het
Phf11a T G 14: 59,284,400 L107F possibly damaging Het
Phlpp2 A T 8: 109,925,829 I602F probably damaging Het
Pik3c2g T A 6: 139,720,147 C65S probably null Het
Pilra A G 5: 137,835,412 F131L probably damaging Het
Pomt2 A C 12: 87,133,460 C256G probably damaging Het
Ppl A T 16: 5,088,878 S1184R probably benign Het
Prkaa1 G T 15: 5,176,911 R416L possibly damaging Het
Prmt2 C T 10: 76,222,556 V140I probably damaging Het
Prodh A T 16: 18,077,789 probably null Het
Psg29 T A 7: 17,211,838 D444E probably damaging Het
Ptgs1 A T 2: 36,251,260 N573I probably damaging Het
Rbm38 C T 2: 173,022,082 P15S probably benign Het
Riox2 T C 16: 59,491,873 S458P possibly damaging Het
Rnase4 T C 14: 51,105,245 V142A possibly damaging Het
Rnf138 A G 18: 21,026,147 N244S probably benign Het
Rnf40 T C 7: 127,597,286 L802P probably damaging Het
Sfxn4 C T 19: 60,851,012 V203M probably damaging Het
Skor2 G T 18: 76,858,954 E124* probably null Het
Slc4a2 G A 5: 24,438,762 S855N probably benign Het
Slc8a2 T C 7: 16,150,583 L626P possibly damaging Het
Slco4c1 G A 1: 96,841,228 P303L probably damaging Het
Slirp A G 12: 87,444,014 T29A probably damaging Het
Snrpd3 G T 10: 75,519,393 C20F possibly damaging Het
Spag17 T A 3: 100,080,118 Y1575N possibly damaging Het
St8sia4 G A 1: 95,667,185 A26V probably benign Het
Stab2 A T 10: 86,863,558 I481N probably benign Het
Tenm2 T A 11: 36,068,381 T1114S probably damaging Het
Tgm1 A G 14: 55,709,935 V323A probably damaging Het
Tmco4 A G 4: 139,058,122 H501R probably damaging Het
Tob1 A T 11: 94,213,741 R34S possibly damaging Het
Trhr2 C T 8: 122,357,371 V297I probably benign Het
Trim30d A C 7: 104,487,958 V13G probably damaging Het
Trpm3 T C 19: 22,885,349 V485A possibly damaging Het
Trrap T C 5: 144,851,179 I3518T probably damaging Het
Ttc27 T C 17: 74,747,755 L352P probably damaging Het
Ush1g A G 11: 115,318,297 L357P possibly damaging Het
Usp24 A G 4: 106,420,447 H2258R probably benign Het
Vcam1 A G 3: 116,124,388 V308A probably damaging Het
Vdr A G 15: 97,857,578 S355P probably benign Het
Vldlr T C 19: 27,238,277 S184P probably damaging Het
Xpo4 C A 14: 57,584,641 A1073S probably benign Het
Zfand2b A G 1: 75,170,990 D224G probably benign Het
Zfp263 A G 16: 3,746,840 R240G possibly damaging Het
Other mutations in Prkdc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00157:Prkdc APN 16 15697226 missense probably damaging 1.00
IGL00225:Prkdc APN 16 15809644 missense possibly damaging 0.64
IGL00481:Prkdc APN 16 15790466 missense probably benign 0.41
IGL00488:Prkdc APN 16 15775847 splice site probably null
IGL00489:Prkdc APN 16 15799926 missense possibly damaging 0.51
IGL00579:Prkdc APN 16 15664239 missense probably damaging 1.00
IGL00587:Prkdc APN 16 15652358 splice site probably benign
IGL00666:Prkdc APN 16 15736835 missense probably damaging 1.00
IGL00675:Prkdc APN 16 15787158 missense probably benign 0.05
IGL00708:Prkdc APN 16 15779426 missense probably damaging 0.97
IGL00725:Prkdc APN 16 15816639 missense probably benign 0.10
IGL00818:Prkdc APN 16 15759754 missense possibly damaging 0.92
IGL00917:Prkdc APN 16 15739564 missense probably damaging 0.98
IGL00990:Prkdc APN 16 15702115 missense probably benign 0.03
IGL01126:Prkdc APN 16 15669321 missense probably benign 0.01
IGL01141:Prkdc APN 16 15726704 missense probably damaging 0.99
IGL01306:Prkdc APN 16 15667731 missense possibly damaging 0.67
IGL01326:Prkdc APN 16 15829692 missense probably benign
IGL01335:Prkdc APN 16 15816896 critical splice donor site probably null
IGL01419:Prkdc APN 16 15835166 missense probably damaging 1.00
IGL01434:Prkdc APN 16 15713587 missense probably benign 0.00
IGL01554:Prkdc APN 16 15652302 missense probably benign 0.05
IGL01671:Prkdc APN 16 15667745 missense possibly damaging 0.90
IGL01871:Prkdc APN 16 15783087 missense probably benign 0.00
IGL01874:Prkdc APN 16 15734994 missense possibly damaging 0.89
IGL01930:Prkdc APN 16 15698887 missense probably damaging 1.00
IGL01984:Prkdc APN 16 15708779 missense probably benign
IGL02121:Prkdc APN 16 15717184 missense probably benign 0.18
IGL02152:Prkdc APN 16 15669285 missense probably benign 0.15
IGL02172:Prkdc APN 16 15809759 missense probably benign 0.10
IGL02336:Prkdc APN 16 15785978 missense possibly damaging 0.47
IGL02336:Prkdc APN 16 15785979 missense probably benign 0.01
IGL02393:Prkdc APN 16 15816758 missense probably benign 0.42
IGL02406:Prkdc APN 16 15670535 missense probably benign 0.00
IGL02500:Prkdc APN 16 15714282 critical splice donor site probably null
IGL02568:Prkdc APN 16 15726542 missense probably damaging 0.98
IGL02579:Prkdc APN 16 15670601 missense possibly damaging 0.83
IGL02652:Prkdc APN 16 15783087 missense probably benign 0.00
IGL02661:Prkdc APN 16 15769825 missense possibly damaging 0.92
IGL02685:Prkdc APN 16 15836043 missense possibly damaging 0.61
IGL02741:Prkdc APN 16 15752726 splice site probably benign
IGL02803:Prkdc APN 16 15833666 splice site probably benign
IGL02866:Prkdc APN 16 15831327 missense probably damaging 1.00
IGL02882:Prkdc APN 16 15651519 nonsense probably null
IGL02989:Prkdc APN 16 15800016 missense possibly damaging 0.67
IGL03053:Prkdc APN 16 15834166 missense probably benign 0.02
IGL03071:Prkdc APN 16 15799984 missense probably benign 0.01
IGL03091:Prkdc APN 16 15705310 splice site probably benign
IGL03100:Prkdc APN 16 15713635 missense probably benign 0.08
IGL03128:Prkdc APN 16 15700744 splice site probably benign
IGL03168:Prkdc APN 16 15834166 missense probably benign 0.02
IGL03204:Prkdc APN 16 15769801 missense probably benign 0.01
IGL03390:Prkdc APN 16 15670626 nonsense probably null
anhimid UTSW 16 15725461 critical splice donor site probably null
Bushtit UTSW 16 15752764 missense probably damaging 0.97
clover UTSW 16 15702157 splice site probably benign
crackle UTSW 16 15786050 critical splice donor site probably null
Daffy UTSW 16 15829697 missense possibly damaging 0.86
darter UTSW 16 15773613 missense possibly damaging 0.93
Elmer_fudd UTSW 16 15808058 missense probably benign 0.01
hobgoblin UTSW 16 15815986 missense probably damaging 1.00
Incubus UTSW 16 15672327 missense probably damaging 1.00
liming UTSW 16 15752829 nonsense probably null
Schreier UTSW 16 15670528 missense probably benign 0.00
screamer UTSW 16 15831282 nonsense probably null
screamer10 UTSW 16 15768025 missense probably damaging 0.98
screamer2 UTSW 16 15652552 critical splice donor site probably null
screamer3 UTSW 16 15740332 critical splice donor site probably null
screamer4 UTSW 16 15783079 missense probably benign 0.00
screamer5 UTSW 16 15687404 missense probably benign
screamer6 UTSW 16 15759605 missense probably damaging 1.00
screamer7 UTSW 16 15654817 splice site probably null
Screamer8 UTSW 16 15719433 missense probably benign 0.00
Screamer9 UTSW 16 15734922 missense probably benign 0.01
Tweetie UTSW 16 15717801 missense probably damaging 1.00
updock UTSW 16 15795094 missense probably benign
ANU23:Prkdc UTSW 16 15667731 missense possibly damaging 0.67
R0008:Prkdc UTSW 16 15708701 splice site probably benign
R0018:Prkdc UTSW 16 15726542 missense probably benign 0.03
R0018:Prkdc UTSW 16 15726542 missense probably benign 0.03
R0069:Prkdc UTSW 16 15726504 missense probably benign 0.03
R0125:Prkdc UTSW 16 15699007 missense probably damaging 0.98
R0131:Prkdc UTSW 16 15713653 missense probably benign 0.09
R0131:Prkdc UTSW 16 15713653 missense probably benign 0.09
R0132:Prkdc UTSW 16 15713653 missense probably benign 0.09
R0137:Prkdc UTSW 16 15740332 critical splice donor site probably null
R0334:Prkdc UTSW 16 15736799 missense probably benign 0.00
R0373:Prkdc UTSW 16 15791927 missense probably damaging 1.00
R0485:Prkdc UTSW 16 15833740 missense probably damaging 0.97
R0511:Prkdc UTSW 16 15831282 nonsense probably null
R0538:Prkdc UTSW 16 15833788 missense probably damaging 1.00
R0595:Prkdc UTSW 16 15808088 missense probably damaging 1.00
R0607:Prkdc UTSW 16 15772057 missense probably damaging 0.98
R0616:Prkdc UTSW 16 15690407 missense probably damaging 1.00
R0630:Prkdc UTSW 16 15810801 missense probably damaging 1.00
R0694:Prkdc UTSW 16 15768637 missense probably damaging 1.00
R0702:Prkdc UTSW 16 15785971 missense possibly damaging 0.95
R0965:Prkdc UTSW 16 15829716 missense probably benign
R1027:Prkdc UTSW 16 15650712 missense possibly damaging 0.80
R1029:Prkdc UTSW 16 15654749 splice site probably benign
R1033:Prkdc UTSW 16 15767951 missense probably damaging 1.00
R1067:Prkdc UTSW 16 15752782 missense probably damaging 0.99
R1116:Prkdc UTSW 16 15783079 missense probably benign 0.00
R1187:Prkdc UTSW 16 15759746 missense probably damaging 0.98
R1226:Prkdc UTSW 16 15673997 missense possibly damaging 0.80
R1279:Prkdc UTSW 16 15690282 missense probably damaging 1.00
R1304:Prkdc UTSW 16 15759723 missense probably damaging 0.99
R1314:Prkdc UTSW 16 15664227 missense possibly damaging 0.68
R1351:Prkdc UTSW 16 15667700 missense possibly damaging 0.62
R1509:Prkdc UTSW 16 15731566 missense probably damaging 1.00
R1512:Prkdc UTSW 16 15687404 missense probably benign
R1531:Prkdc UTSW 16 15772106 missense probably benign 0.01
R1579:Prkdc UTSW 16 15675328 missense probably benign 0.00
R1669:Prkdc UTSW 16 15734058 missense probably damaging 1.00
R1682:Prkdc UTSW 16 15676989 missense probably benign 0.19
R1713:Prkdc UTSW 16 15795094 missense probably benign
R1762:Prkdc UTSW 16 15637961 missense probably benign
R1789:Prkdc UTSW 16 15739524 missense probably damaging 1.00
R1822:Prkdc UTSW 16 15759605 missense probably damaging 1.00
R1848:Prkdc UTSW 16 15808058 missense probably benign 0.01
R1887:Prkdc UTSW 16 15829635 missense probably benign 0.00
R1891:Prkdc UTSW 16 15725436 missense probably benign 0.02
R1921:Prkdc UTSW 16 15714215 missense possibly damaging 0.80
R1922:Prkdc UTSW 16 15714266 missense probably benign 0.00
R1929:Prkdc UTSW 16 15654817 splice site probably null
R1939:Prkdc UTSW 16 15835913 missense possibly damaging 0.95
R2021:Prkdc UTSW 16 15677009 missense probably benign 0.00
R2033:Prkdc UTSW 16 15687352 splice site probably benign
R2056:Prkdc UTSW 16 15727605 missense probably benign 0.03
R2057:Prkdc UTSW 16 15727605 missense probably benign 0.03
R2058:Prkdc UTSW 16 15727605 missense probably benign 0.03
R2082:Prkdc UTSW 16 15715963 missense probably damaging 1.00
R2109:Prkdc UTSW 16 15687390 missense probably benign 0.01
R2124:Prkdc UTSW 16 15719433 missense probably benign 0.00
R2164:Prkdc UTSW 16 15705207 missense probably damaging 1.00
R2174:Prkdc UTSW 16 15734922 missense probably benign 0.01
R2191:Prkdc UTSW 16 15698824 missense probably damaging 1.00
R2270:Prkdc UTSW 16 15654817 splice site probably null
R2271:Prkdc UTSW 16 15654817 splice site probably null
R2272:Prkdc UTSW 16 15654817 splice site probably null
R2356:Prkdc UTSW 16 15684204 missense probably benign
R2852:Prkdc UTSW 16 15652552 critical splice donor site probably null
R3115:Prkdc UTSW 16 15664358 missense probably benign 0.01
R3116:Prkdc UTSW 16 15664358 missense probably benign 0.01
R3499:Prkdc UTSW 16 15768025 missense probably damaging 0.98
R3687:Prkdc UTSW 16 15799967 missense probably benign
R3834:Prkdc UTSW 16 15791946 missense probably damaging 1.00
R3835:Prkdc UTSW 16 15791946 missense probably damaging 1.00
R3961:Prkdc UTSW 16 15829611 splice site probably null
R4151:Prkdc UTSW 16 15816773 missense probably benign
R4233:Prkdc UTSW 16 15835919 missense probably benign 0.11
R4281:Prkdc UTSW 16 15806099 splice site probably null
R4296:Prkdc UTSW 16 15737905 missense probably damaging 0.99
R4344:Prkdc UTSW 16 15768022 missense probably damaging 0.98
R4424:Prkdc UTSW 16 15773739 missense probably damaging 0.98
R4424:Prkdc UTSW 16 15836082 missense probably damaging 1.00
R4497:Prkdc UTSW 16 15700653 missense probably benign 0.43
R4549:Prkdc UTSW 16 15736870 missense possibly damaging 0.89
R4594:Prkdc UTSW 16 15767966 missense possibly damaging 0.64
R4603:Prkdc UTSW 16 15810824 missense probably damaging 0.98
R4615:Prkdc UTSW 16 15663074 missense probably damaging 0.99
R4648:Prkdc UTSW 16 15816774 missense probably benign 0.05
R4662:Prkdc UTSW 16 15734052 missense probably damaging 1.00
R4680:Prkdc UTSW 16 15772030 missense probably benign 0.00
R4700:Prkdc UTSW 16 15702112 missense probably damaging 1.00
R4716:Prkdc UTSW 16 15810837 missense probably benign 0.32
R4720:Prkdc UTSW 16 15667715 missense probably benign
R4785:Prkdc UTSW 16 15648976 missense probably benign 0.21
R4822:Prkdc UTSW 16 15650712 missense possibly damaging 0.80
R4829:Prkdc UTSW 16 15702075 missense possibly damaging 0.80
R4981:Prkdc UTSW 16 15678309 missense probably damaging 1.00
R4989:Prkdc UTSW 16 15673997 missense possibly damaging 0.80
R5059:Prkdc UTSW 16 15838018 missense probably damaging 1.00
R5115:Prkdc UTSW 16 15790580 missense probably benign
R5151:Prkdc UTSW 16 15716035 missense probably damaging 1.00
R5165:Prkdc UTSW 16 15678272 missense probably damaging 1.00
R5215:Prkdc UTSW 16 15772121 missense possibly damaging 0.64
R5270:Prkdc UTSW 16 15734955 missense probably damaging 1.00
R5278:Prkdc UTSW 16 15714974 missense probably damaging 1.00
R5351:Prkdc UTSW 16 15831312 missense probably benign 0.03
R5416:Prkdc UTSW 16 15805950 missense probably damaging 1.00
R5418:Prkdc UTSW 16 15795097 missense probably benign 0.20
R5437:Prkdc UTSW 16 15769875 missense possibly damaging 0.46
R5452:Prkdc UTSW 16 15768637 missense possibly damaging 0.96
R5518:Prkdc UTSW 16 15678308 missense probably damaging 1.00
R5538:Prkdc UTSW 16 15651469 missense probably damaging 1.00
R5589:Prkdc UTSW 16 15706791 missense probably benign 0.02
R5618:Prkdc UTSW 16 15809612 missense probably damaging 1.00
R5640:Prkdc UTSW 16 15829769 missense possibly damaging 0.86
R5661:Prkdc UTSW 16 15810770 missense possibly damaging 0.81
R5771:Prkdc UTSW 16 15664233 missense probably damaging 1.00
R5772:Prkdc UTSW 16 15779388 missense possibly damaging 0.49
R5783:Prkdc UTSW 16 15717801 missense probably damaging 1.00
R5792:Prkdc UTSW 16 15816752 missense probably damaging 1.00
R5797:Prkdc UTSW 16 15737834 nonsense probably null
R5826:Prkdc UTSW 16 15734098 missense probably benign
R5883:Prkdc UTSW 16 15715914 missense probably benign
R5895:Prkdc UTSW 16 15752829 nonsense probably null
R5998:Prkdc UTSW 16 15783157 missense probably damaging 1.00
R6000:Prkdc UTSW 16 15829697 missense possibly damaging 0.86
R6120:Prkdc UTSW 16 15739471 missense probably benign 0.00
R6145:Prkdc UTSW 16 15772073 missense probably damaging 1.00
R6209:Prkdc UTSW 16 15790592 missense probably damaging 1.00
R6293:Prkdc UTSW 16 15787155 missense probably benign 0.00
R6321:Prkdc UTSW 16 15714919 missense probably benign
R6376:Prkdc UTSW 16 15769885 missense probably benign 0.06
R6387:Prkdc UTSW 16 15698815 missense probably benign 0.01
R6406:Prkdc UTSW 16 15717801 missense probably damaging 1.00
R6469:Prkdc UTSW 16 15795075 missense probably benign 0.10
R6486:Prkdc UTSW 16 15752764 missense probably damaging 0.97
R6665:Prkdc UTSW 16 15786050 critical splice donor site probably null
R6703:Prkdc UTSW 16 15670528 missense probably benign 0.00
R6774:Prkdc UTSW 16 15725461 critical splice donor site probably null
R6854:Prkdc UTSW 16 15651538 missense probably damaging 1.00
R6878:Prkdc UTSW 16 15777072 missense probably benign 0.31
R6882:Prkdc UTSW 16 15783263 critical splice donor site probably null
R6882:Prkdc UTSW 16 15808156 missense probably benign 0.33
R6949:Prkdc UTSW 16 15799989 missense probably benign
R6950:Prkdc UTSW 16 15815986 missense probably damaging 1.00
R7019:Prkdc UTSW 16 15769966 missense probably benign 0.00
R7064:Prkdc UTSW 16 15790453 missense probably benign 0.00
R7097:Prkdc UTSW 16 15689343 missense probably damaging 1.00
R7201:Prkdc UTSW 16 15698803 missense probably benign 0.12
R7235:Prkdc UTSW 16 15714263 missense probably benign
R7283:Prkdc UTSW 16 15717764 missense probably benign 0.00
R7401:Prkdc UTSW 16 15648738 missense probably damaging 1.00
R7525:Prkdc UTSW 16 15672327 missense probably damaging 1.00
R7647:Prkdc UTSW 16 15737943 missense probably damaging 1.00
R7679:Prkdc UTSW 16 15831319 missense probably damaging 1.00
R7803:Prkdc UTSW 16 15806096 missense probably null 0.05
R7858:Prkdc UTSW 16 15689277 missense probably benign 0.11
R7872:Prkdc UTSW 16 15715006 missense probably benign 0.05
R7896:Prkdc UTSW 16 15708903 missense probably damaging 0.97
R8032:Prkdc UTSW 16 15779451 missense probably benign 0.00
R8055:Prkdc UTSW 16 15816885 missense probably benign 0.09
R8153:Prkdc UTSW 16 15664244 missense probably damaging 1.00
R8281:Prkdc UTSW 16 15705253 missense probably damaging 1.00
R8302:Prkdc UTSW 16 15836082 missense probably damaging 1.00
R8322:Prkdc UTSW 16 15714141 splice site probably benign
R8401:Prkdc UTSW 16 15773613 missense possibly damaging 0.93
R8440:Prkdc UTSW 16 15835158 frame shift probably null
R8458:Prkdc UTSW 16 15790676 critical splice donor site probably null
R8472:Prkdc UTSW 16 15651536 missense probably damaging 1.00
R8478:Prkdc UTSW 16 15648924 missense probably benign 0.00
R8515:Prkdc UTSW 16 15664368 missense probably damaging 1.00
R8546:Prkdc UTSW 16 15663035 missense probably damaging 1.00
X0023:Prkdc UTSW 16 15740278 missense probably benign
Z1176:Prkdc UTSW 16 15687422 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACCCATACACTAATGGTACTATTGG -3'
(R):5'- CCAAGCATGTCTAGCTACAGTC -3'

Sequencing Primer
(F):5'- GGATTTTATTGCTTATTTTTGCATGC -3'
(R):5'- AAAAGGCCTGGTCATGTGTTACC -3'
Posted On2016-06-06