Incidental Mutation 'R5075:4931408C20Rik'
ID386903
Institutional Source Beutler Lab
Gene Symbol 4931408C20Rik
Ensembl Gene ENSMUSG00000073722
Gene NameRIKEN cDNA 4931408C20 gene
Synonyms
MMRRC Submission 042664-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5075 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location26681814-26687460 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 26683052 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 1016 (K1016E)
Ref Sequence ENSEMBL: ENSMUSP00000095410 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097801]
Predicted Effect probably damaging
Transcript: ENSMUST00000097801
AA Change: K1016E

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000095410
Gene: ENSMUSG00000073722
AA Change: K1016E

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
Pfam:FAM75 128 474 4.6e-28 PFAM
internal_repeat_1 939 1112 4.27e-16 PROSPERO
internal_repeat_1 1204 1376 4.27e-16 PROSPERO
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.3%
Validation Efficiency 100% (57/57)
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agl A G 3: 116,793,807 F33S probably damaging Het
Atf7ip A G 6: 136,560,234 D163G probably benign Het
Cep85 C A 4: 134,132,367 D662Y probably damaging Het
Cntn6 T A 6: 104,833,030 S558T probably damaging Het
Dnah8 T C 17: 30,739,757 probably null Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Dnah8 T A 17: 30,800,531 N3859K probably damaging Het
Dnajc21 G T 15: 10,461,877 T146K probably benign Het
Ep400 T C 5: 110,685,485 E1957G unknown Het
Esm1 A G 13: 113,213,358 Y104C probably damaging Het
Fkbp15 T C 4: 62,321,029 K613R probably damaging Het
Gm10722 A C 9: 3,001,041 Y39S probably benign Het
Gm5592 A G 7: 41,158,963 probably benign Het
Hdac4 A G 1: 91,996,120 S223P probably benign Het
Hypk A G 2: 121,455,630 probably benign Het
Kpna1 T A 16: 36,009,352 F70I probably damaging Het
Lrp2 A G 2: 69,465,758 Y3336H probably benign Het
Mettl7b A G 10: 128,960,680 F87L probably damaging Het
Mier1 A G 4: 103,139,473 D99G probably benign Het
Muc4 T C 16: 32,754,794 probably benign Het
Nup160 A G 2: 90,700,174 E463G probably damaging Het
Olfr1480 T A 19: 13,530,273 M244K probably benign Het
Peg3 A T 7: 6,708,420 C1268S probably damaging Het
Recql4 G A 15: 76,709,544 P122L probably damaging Het
Rex2 A T 4: 147,057,694 Q213L possibly damaging Het
Rnf25 A G 1: 74,595,644 V73A probably benign Het
Sacm1l A G 9: 123,582,262 D372G probably benign Het
Selplg T C 5: 113,819,984 D87G probably benign Het
Sgsh G A 11: 119,346,768 T340M probably benign Het
Slc4a3 A T 1: 75,557,368 I1120F probably damaging Het
Snrnp40 T C 4: 130,388,582 Y311H probably benign Het
Stard7 A T 2: 127,269,959 probably benign Het
Stat1 A T 1: 52,122,712 K40M possibly damaging Het
Sun1 T C 5: 139,226,891 probably null Het
Tet2 T A 3: 133,486,906 Q589L probably benign Het
Tmc7 A T 7: 118,552,696 probably null Het
Unc79 A T 12: 103,074,954 I749F possibly damaging Het
Ust A G 10: 8,518,224 F59S probably damaging Het
Wdr81 A T 11: 75,452,481 D653E probably benign Het
Zfat A G 15: 68,180,230 S572P probably benign Het
Zmynd15 G C 11: 70,462,120 E143D probably damaging Het
Zzef1 A G 11: 72,858,344 E886G probably damaging Het
Other mutations in 4931408C20Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00540:4931408C20Rik APN 1 26684977 missense probably benign 0.00
IGL00575:4931408C20Rik APN 1 26682932 missense possibly damaging 0.51
IGL00656:4931408C20Rik APN 1 26682901 missense possibly damaging 0.71
IGL00671:4931408C20Rik APN 1 26684859 missense possibly damaging 0.50
IGL00777:4931408C20Rik APN 1 26682092 missense probably damaging 1.00
IGL00824:4931408C20Rik APN 1 26683589 missense possibly damaging 0.48
IGL01018:4931408C20Rik APN 1 26682910 missense probably damaging 0.99
IGL01148:4931408C20Rik APN 1 26685172 missense probably benign 0.22
IGL01631:4931408C20Rik APN 1 26685414 missense probably damaging 0.98
IGL01901:4931408C20Rik APN 1 26682584 missense probably benign 0.13
IGL01957:4931408C20Rik APN 1 26685259 missense probably damaging 0.98
IGL02031:4931408C20Rik APN 1 26685023 missense probably damaging 0.99
IGL02596:4931408C20Rik APN 1 26684002 missense probably benign 0.00
PIT4486001:4931408C20Rik UTSW 1 26685329 missense probably damaging 0.99
R0026:4931408C20Rik UTSW 1 26683369 missense probably benign 0.00
R0026:4931408C20Rik UTSW 1 26683369 missense probably benign 0.00
R0043:4931408C20Rik UTSW 1 26683802 missense possibly damaging 0.72
R0141:4931408C20Rik UTSW 1 26683782 missense probably benign 0.00
R0145:4931408C20Rik UTSW 1 26687332 missense probably benign 0.00
R0158:4931408C20Rik UTSW 1 26683951 missense probably damaging 0.98
R0325:4931408C20Rik UTSW 1 26685266 missense possibly damaging 0.91
R0627:4931408C20Rik UTSW 1 26685889 missense probably benign 0.00
R0733:4931408C20Rik UTSW 1 26682932 missense possibly damaging 0.51
R1033:4931408C20Rik UTSW 1 26682385 missense probably benign
R1074:4931408C20Rik UTSW 1 26683226 missense probably benign 0.00
R1108:4931408C20Rik UTSW 1 26682466 missense possibly damaging 0.85
R1139:4931408C20Rik UTSW 1 26682665 missense probably benign 0.04
R1326:4931408C20Rik UTSW 1 26683930 missense probably damaging 1.00
R1398:4931408C20Rik UTSW 1 26685341 missense possibly damaging 0.82
R1422:4931408C20Rik UTSW 1 26682466 missense possibly damaging 0.85
R1463:4931408C20Rik UTSW 1 26682141 nonsense probably null
R1485:4931408C20Rik UTSW 1 26685880 missense possibly damaging 0.92
R1568:4931408C20Rik UTSW 1 26685869 missense probably benign 0.01
R1603:4931408C20Rik UTSW 1 26685569 missense probably damaging 0.99
R1605:4931408C20Rik UTSW 1 26684430 missense possibly damaging 0.92
R1795:4931408C20Rik UTSW 1 26682989 nonsense probably null
R1945:4931408C20Rik UTSW 1 26682314 missense probably benign 0.04
R1967:4931408C20Rik UTSW 1 26683373 missense probably benign 0.02
R2055:4931408C20Rik UTSW 1 26685732 missense possibly damaging 0.86
R2093:4931408C20Rik UTSW 1 26682141 nonsense probably null
R2131:4931408C20Rik UTSW 1 26685854 missense probably benign 0.11
R2237:4931408C20Rik UTSW 1 26685160 missense possibly damaging 0.82
R2314:4931408C20Rik UTSW 1 26684702 missense probably benign 0.00
R2407:4931408C20Rik UTSW 1 26682838 missense possibly damaging 0.86
R2993:4931408C20Rik UTSW 1 26685828 missense possibly damaging 0.83
R4245:4931408C20Rik UTSW 1 26682080 missense probably benign 0.00
R4567:4931408C20Rik UTSW 1 26683117 missense probably benign
R4605:4931408C20Rik UTSW 1 26683186 missense probably benign 0.45
R4708:4931408C20Rik UTSW 1 26684440 missense possibly damaging 0.92
R4827:4931408C20Rik UTSW 1 26685842 missense possibly damaging 0.91
R4839:4931408C20Rik UTSW 1 26685359 missense probably benign 0.11
R4888:4931408C20Rik UTSW 1 26683547 missense probably benign 0.00
R5101:4931408C20Rik UTSW 1 26683336 missense possibly damaging 0.92
R5231:4931408C20Rik UTSW 1 26683951 missense possibly damaging 0.79
R5310:4931408C20Rik UTSW 1 26685088 missense probably benign 0.00
R5459:4931408C20Rik UTSW 1 26685191 missense probably damaging 0.96
R5520:4931408C20Rik UTSW 1 26685819 missense probably benign 0.00
R5608:4931408C20Rik UTSW 1 26683048 missense probably damaging 0.97
R5960:4931408C20Rik UTSW 1 26683144 missense probably benign 0.34
R6128:4931408C20Rik UTSW 1 26685425 missense probably benign 0.38
R6188:4931408C20Rik UTSW 1 26685703 missense probably damaging 0.99
R6319:4931408C20Rik UTSW 1 26685401 missense probably benign 0.38
R6339:4931408C20Rik UTSW 1 26682505 missense probably benign 0.01
R6431:4931408C20Rik UTSW 1 26684030 missense probably benign 0.11
R6456:4931408C20Rik UTSW 1 26685169 missense probably damaging 0.99
R6562:4931408C20Rik UTSW 1 26682362 missense possibly damaging 0.91
R6645:4931408C20Rik UTSW 1 26683117 missense probably benign 0.06
R6647:4931408C20Rik UTSW 1 26682578 missense probably damaging 0.99
R6919:4931408C20Rik UTSW 1 26682934 missense probably benign 0.15
R7085:4931408C20Rik UTSW 1 26683465 missense possibly damaging 0.95
R7183:4931408C20Rik UTSW 1 26682833 missense probably benign 0.27
R7347:4931408C20Rik UTSW 1 26684467 missense probably benign 0.02
R7488:4931408C20Rik UTSW 1 26683958 missense possibly damaging 0.77
R7565:4931408C20Rik UTSW 1 26685270 missense probably benign 0.00
R7726:4931408C20Rik UTSW 1 26684498 missense probably benign 0.08
X0025:4931408C20Rik UTSW 1 26682505 missense probably benign 0.00
X0061:4931408C20Rik UTSW 1 26682569 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- AGTGGATCACAGTCCACTCC -3'
(R):5'- TGAGTGTCTCTATGACCCAAACC -3'

Sequencing Primer
(F):5'- GGATCACAGTCCACTCCTTTGTTTG -3'
(R):5'- TGGCCACACCAGCTCTGAG -3'
Posted On2016-06-06