Incidental Mutation 'R5075:Fkbp15'
ID386915
Institutional Source Beutler Lab
Gene Symbol Fkbp15
Ensembl Gene ENSMUSG00000066151
Gene NameFK506 binding protein 15
SynonymsFKBP133, C430014M02Rik
MMRRC Submission 042664-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5075 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location62300342-62360548 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 62321029 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 613 (K613R)
Ref Sequence ENSEMBL: ENSMUSP00000081575 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084527] [ENSMUST00000084528] [ENSMUST00000098033] [ENSMUST00000107461]
Predicted Effect probably damaging
Transcript: ENSMUST00000084527
AA Change: K613R

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000081575
Gene: ENSMUSG00000066151
AA Change: K613R

DomainStartEndE-ValueType
low complexity region 59 68 N/A INTRINSIC
Pfam:FKBP_C 190 286 4.8e-21 PFAM
low complexity region 302 322 N/A INTRINSIC
low complexity region 326 338 N/A INTRINSIC
internal_repeat_1 403 431 1.88e-10 PROSPERO
internal_repeat_1 472 500 1.88e-10 PROSPERO
coiled coil region 560 662 N/A INTRINSIC
coiled coil region 684 790 N/A INTRINSIC
coiled coil region 816 865 N/A INTRINSIC
coiled coil region 916 943 N/A INTRINSIC
low complexity region 952 964 N/A INTRINSIC
low complexity region 983 994 N/A INTRINSIC
low complexity region 1034 1045 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000084528
AA Change: K613R

PolyPhen 2 Score 0.866 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000081576
Gene: ENSMUSG00000066151
AA Change: K613R

DomainStartEndE-ValueType
low complexity region 59 68 N/A INTRINSIC
Pfam:FKBP_C 190 286 2.4e-21 PFAM
low complexity region 302 322 N/A INTRINSIC
low complexity region 326 338 N/A INTRINSIC
internal_repeat_1 403 431 2.74e-10 PROSPERO
internal_repeat_1 472 500 2.74e-10 PROSPERO
coiled coil region 560 662 N/A INTRINSIC
coiled coil region 684 745 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000098033
AA Change: K613R

PolyPhen 2 Score 0.922 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000095641
Gene: ENSMUSG00000066151
AA Change: K613R

DomainStartEndE-ValueType
low complexity region 59 68 N/A INTRINSIC
Pfam:FKBP_C 190 286 1.9e-21 PFAM
low complexity region 302 322 N/A INTRINSIC
low complexity region 326 338 N/A INTRINSIC
internal_repeat_1 403 431 1.79e-8 PROSPERO
internal_repeat_1 472 500 1.79e-8 PROSPERO
coiled coil region 560 608 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000107461
AA Change: K613R

PolyPhen 2 Score 0.693 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000103085
Gene: ENSMUSG00000066151
AA Change: K613R

DomainStartEndE-ValueType
low complexity region 59 68 N/A INTRINSIC
Pfam:FKBP_C 190 286 2e-21 PFAM
low complexity region 302 322 N/A INTRINSIC
low complexity region 326 338 N/A INTRINSIC
internal_repeat_1 403 431 1.86e-8 PROSPERO
internal_repeat_1 472 500 1.86e-8 PROSPERO
coiled coil region 560 608 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139308
Meta Mutation Damage Score 0.0784 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.3%
Validation Efficiency 100% (57/57)
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik T C 1: 26,683,052 K1016E probably damaging Het
Agl A G 3: 116,793,807 F33S probably damaging Het
Atf7ip A G 6: 136,560,234 D163G probably benign Het
Cep85 C A 4: 134,132,367 D662Y probably damaging Het
Cntn6 T A 6: 104,833,030 S558T probably damaging Het
Dnah8 T C 17: 30,739,757 probably null Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Dnah8 T A 17: 30,800,531 N3859K probably damaging Het
Dnajc21 G T 15: 10,461,877 T146K probably benign Het
Ep400 T C 5: 110,685,485 E1957G unknown Het
Esm1 A G 13: 113,213,358 Y104C probably damaging Het
Gm10722 A C 9: 3,001,041 Y39S probably benign Het
Gm5592 A G 7: 41,158,963 probably benign Het
Hdac4 A G 1: 91,996,120 S223P probably benign Het
Hypk A G 2: 121,455,630 probably benign Het
Kpna1 T A 16: 36,009,352 F70I probably damaging Het
Lrp2 A G 2: 69,465,758 Y3336H probably benign Het
Mettl7b A G 10: 128,960,680 F87L probably damaging Het
Mier1 A G 4: 103,139,473 D99G probably benign Het
Muc4 T C 16: 32,754,794 probably benign Het
Nup160 A G 2: 90,700,174 E463G probably damaging Het
Olfr1480 T A 19: 13,530,273 M244K probably benign Het
Peg3 A T 7: 6,708,420 C1268S probably damaging Het
Recql4 G A 15: 76,709,544 P122L probably damaging Het
Rex2 A T 4: 147,057,694 Q213L possibly damaging Het
Rnf25 A G 1: 74,595,644 V73A probably benign Het
Sacm1l A G 9: 123,582,262 D372G probably benign Het
Selplg T C 5: 113,819,984 D87G probably benign Het
Sgsh G A 11: 119,346,768 T340M probably benign Het
Slc4a3 A T 1: 75,557,368 I1120F probably damaging Het
Snrnp40 T C 4: 130,388,582 Y311H probably benign Het
Stard7 A T 2: 127,269,959 probably benign Het
Stat1 A T 1: 52,122,712 K40M possibly damaging Het
Sun1 T C 5: 139,226,891 probably null Het
Tet2 T A 3: 133,486,906 Q589L probably benign Het
Tmc7 A T 7: 118,552,696 probably null Het
Unc79 A T 12: 103,074,954 I749F possibly damaging Het
Ust A G 10: 8,518,224 F59S probably damaging Het
Wdr81 A T 11: 75,452,481 D653E probably benign Het
Zfat A G 15: 68,180,230 S572P probably benign Het
Zmynd15 G C 11: 70,462,120 E143D probably damaging Het
Zzef1 A G 11: 72,858,344 E886G probably damaging Het
Other mutations in Fkbp15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00659:Fkbp15 APN 4 62333680 splice site probably benign
IGL01326:Fkbp15 APN 4 62323250 missense probably damaging 0.98
IGL01822:Fkbp15 APN 4 62352504 missense probably benign
IGL01925:Fkbp15 APN 4 62323213 missense probably damaging 1.00
IGL02190:Fkbp15 APN 4 62304822 missense possibly damaging 0.69
IGL02276:Fkbp15 APN 4 62336466 nonsense probably null
IGL02310:Fkbp15 APN 4 62340316 missense probably damaging 1.00
IGL02954:Fkbp15 APN 4 62321065 splice site probably benign
IGL02967:Fkbp15 APN 4 62304390 missense probably damaging 0.96
IGL03136:Fkbp15 APN 4 62340229 splice site probably benign
IGL03185:Fkbp15 APN 4 62332186 splice site probably null
IGL03280:Fkbp15 APN 4 62303267 unclassified probably benign
dura UTSW 4 62324126 missense probably damaging 0.96
mater UTSW 4 62326136 missense probably benign 0.22
R0419:Fkbp15 UTSW 4 62326136 missense probably benign 0.22
R0838:Fkbp15 UTSW 4 62324126 missense probably damaging 0.96
R1241:Fkbp15 UTSW 4 62304609 missense possibly damaging 0.87
R1394:Fkbp15 UTSW 4 62327872 missense probably benign 0.00
R1622:Fkbp15 UTSW 4 62323202 missense possibly damaging 0.94
R1682:Fkbp15 UTSW 4 62324194 missense probably damaging 0.98
R1823:Fkbp15 UTSW 4 62337091 missense probably damaging 1.00
R1994:Fkbp15 UTSW 4 62304381 missense probably benign 0.00
R2132:Fkbp15 UTSW 4 62327899 missense probably damaging 1.00
R2133:Fkbp15 UTSW 4 62327899 missense probably damaging 1.00
R2425:Fkbp15 UTSW 4 62312365 missense probably benign 0.00
R2938:Fkbp15 UTSW 4 62304663 missense probably benign 0.23
R3034:Fkbp15 UTSW 4 62306892 splice site probably null
R3957:Fkbp15 UTSW 4 62334252 missense probably benign 0.01
R3963:Fkbp15 UTSW 4 62340677 missense probably damaging 1.00
R4235:Fkbp15 UTSW 4 62336456 missense probably benign 0.38
R4334:Fkbp15 UTSW 4 62303219 missense possibly damaging 0.95
R4366:Fkbp15 UTSW 4 62336414 missense probably benign 0.38
R4717:Fkbp15 UTSW 4 62308069 missense probably damaging 1.00
R4790:Fkbp15 UTSW 4 62307997 missense probably benign 0.05
R5176:Fkbp15 UTSW 4 62312323 missense possibly damaging 0.68
R5419:Fkbp15 UTSW 4 62327877 missense probably damaging 0.98
R5503:Fkbp15 UTSW 4 62327887 missense probably benign 0.05
R5731:Fkbp15 UTSW 4 62306929 missense probably benign 0.01
R5733:Fkbp15 UTSW 4 62306929 missense probably benign 0.01
R5820:Fkbp15 UTSW 4 62345546 missense probably benign 0.00
R5878:Fkbp15 UTSW 4 62306908 missense probably benign
R5898:Fkbp15 UTSW 4 62326057 critical splice donor site probably null
R5914:Fkbp15 UTSW 4 62327810 splice site probably null
R6113:Fkbp15 UTSW 4 62340647 missense probably benign 0.38
R6377:Fkbp15 UTSW 4 62324192 missense probably damaging 1.00
R6427:Fkbp15 UTSW 4 62323202 missense probably benign 0.01
R6464:Fkbp15 UTSW 4 62308078 missense possibly damaging 0.92
R6528:Fkbp15 UTSW 4 62332270 missense probably damaging 1.00
R6790:Fkbp15 UTSW 4 62304759 missense probably benign 0.01
R6880:Fkbp15 UTSW 4 62336495 missense possibly damaging 0.71
R6911:Fkbp15 UTSW 4 62340290 missense probably damaging 1.00
R7371:Fkbp15 UTSW 4 62321056 missense possibly damaging 0.89
R7410:Fkbp15 UTSW 4 62340299 missense probably damaging 1.00
R7660:Fkbp15 UTSW 4 62314341 missense probably benign 0.08
X0013:Fkbp15 UTSW 4 62312370 missense probably benign 0.36
Predicted Primers PCR Primer
(F):5'- GATGGCAAATATCCTGCTGC -3'
(R):5'- CAGGTCTCAGGAAAGCAATGTG -3'

Sequencing Primer
(F):5'- GCACAGAAACTGGGAAGTTCTTTTG -3'
(R):5'- GGAACTAAACCAGGGTCCTCTG -3'
Posted On2016-06-06